De Novo Small Rna Transcriptome Assembly For Non-Model Species?
2
4
Entering edit mode
12.3 years ago
Ahdf-Lell-Kocks ★ 1.6k

What are the recommended tools for de novo assembly of Illumina sequencing of small RNAs (like miRNAs, snoRNAs, etc) of a read length of 36bp for a eukaryote multicellular species without a reference genome?

I tried the latest version of Trinity with default parameters on the public dataset from the SRA:

http://www.ncbi.nlm.nih.gov/sra?term=SRR057742

And it only gives me 1 transcript back:

~/trinityrnaseq_r2012-01-25/Trinity.pl --kmer_method meryl \
--seqType fq --single SRR057742.fastq --CPU 1

>comp1_c0_seq1 len=206 path=[1:0-205]
AAGCAGAAGACGGCATACGACCAAGGCCTCTAGTCATTCGCTTTACCGGATAAAACTGCT
CAGCGAGCGCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGA
TTAGTCTTTCGCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTGCGG
GCCTCCACCAGAGTTTCCCCTGGCTT

Any ideas what I can try?

transcriptome assembly small • 4.7k views
ADD COMMENT
0
Entering edit mode

it depends on how the libraire is prepared. In general, with small RNA sequencing, the librairie is enriched in miRNA and other small ncRNA. So the lib is not mRNA enriched.

ADD REPLY
0
Entering edit mode

What does the parameters of trinity mean? K=25 --seqType fq --min_contig_length 100 --min_glue 4 --group_pairs_distance 250 --min_kmer_cov 4

ADD REPLY
0
Entering edit mode

Please post this as a new question.

ADD REPLY
1
Entering edit mode
ADD COMMENT
0
Entering edit mode

Thanks for the suggestion. I tried it with default parameters but didn't get much out from it... Any suggestions?

ADD REPLY
0
Entering edit mode
12.3 years ago
Pasta ★ 1.3k

Try Edena if you are working with prokaryotes

ADD COMMENT

Login before adding your answer.

Traffic: 2113 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6