Should I trim adapter for single-end RNASeq reads?

Question

[ddzhangzz]

In my knowledge, it is necessary to check and trim adapters for paired-end RNASeq reads because some inserts might be too short and that leads to adapters being sequenced into reads. But for single end, it seems not necessary because there is no way to sequence to adapter. Is this right?

Answer 1

[Devon Ryan]

You're just as likely to sequence into the adapter with SE reads as PE reads. If you're doing end-to-end alignment then you really need to trim adapters (with local alignment it's not so important).

[ddzhangzz]

Thanks @Devon. The sequencing center gave me two adapter sequences:

>TruSeq_Universal_Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>TruSeq_Adapter_Index_1
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

I am wondering why there are two adapters and which one should I use as to trim off?

[GenoMax]

Use one of the standard trimming programs (trimmomatic, bbduk.sh from BBMap). BBMap includes a file with common adapters. You don't need to worry about selecting a specific one.