Question: Do I need to download any specific adapters for Illumina small RNA sequencing kit?
0
gravatar for bioinforesearchquestions
6 months ago by
United States

Hi Friends,

Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The reads from this run would have bases sequenced from the adapters and primers. I am planning to trim off the adapters and primers.

I am currently using Trimmomatic tool for trimming process. Along with the tool, I have a list of adapters in FASTA format. Within Trimmomatic tool, there is a folder named "Adapters". It has following files

  • Illumina_Adapter_Full.txt
  • IlluminaAdapter-PE.fa
  • Illumina-MultiplexingPrimer.fa
  • Illumina-SmallRNAAdapter.fa
  • Illumina-TruSeqAdapter.fa
  • NexteraPE-PE.fa
  • TruSeq2-PE.fa
  • TruSeq2-SE.fa
  • TruSeq3-PE-2.fa
  • TruSeq3-PE.fa
  • TruSeq3-SE.fa

In my case, I used "Illumina-SmallRNAAdapter.fa" and "Illumina-MultiplexingPrimer.fa" for trimming the reads.

Illumina-SmallRNAAdapter.fa

RNA 3 Adapter TGGAATTCTCGGGTGCCAAGG

Do I need download any specific adapters for Illumina small RNA sequencing kit?

ADD COMMENTlink modified 6 months ago • written 6 months ago by bioinforesearchquestions90
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 535 users visited in the last hour