Do I need to download any specific adapters for Illumina small RNA sequencing kit?
1
0
Entering edit mode
4.2 years ago

Hi Friends,

Recently we sequenced small RNA sequencing using Rapid Run platform. As the size of the small RNA ranges between 18 to 35bases. The reads from this run would have bases sequenced from the adapters and primers. I am planning to trim off the adapters and primers.

I am currently using Trimmomatic tool for trimming process. Along with the tool, I have a list of adapters in FASTA format. Within Trimmomatic tool, there is a folder named "Adapters". It has following files

  • Illumina_Adapter_Full.txt
  • IlluminaAdapter-PE.fa
  • Illumina-MultiplexingPrimer.fa
  • Illumina-SmallRNAAdapter.fa
  • Illumina-TruSeqAdapter.fa
  • NexteraPE-PE.fa
  • TruSeq2-PE.fa
  • TruSeq2-SE.fa
  • TruSeq3-PE-2.fa
  • TruSeq3-PE.fa
  • TruSeq3-SE.fa

In my case, I used "Illumina-SmallRNAAdapter.fa" and "Illumina-MultiplexingPrimer.fa" for trimming the reads.

Illumina-SmallRNAAdapter.fa

RNA 3 Adapter TGGAATTCTCGGGTGCCAAGG

Do I need download any specific adapters for Illumina small RNA sequencing kit?

Adapter trimming small RNA trimmomatic cutadapt • 1.9k views
ADD COMMENT
0
Entering edit mode

Illumina_Adapter_Full.txt IlluminaAdapter-PE.fa Illumina-MultiplexingPrimer.fa Illumina-SmallRNAAdapter.fa Illumina-TruSeqAdapter.fa

can any one provide these files link?

ADD REPLY
0
Entering edit mode

Files currently include with trimmomatic should cover all necessary Illumina adapters.

With small RNA kits there may be a kit specific adapter sequence so you should always check which kit was used and follow data processing instructions (if provided).

ADD REPLY
0
Entering edit mode
4 weeks ago
swbarnes2 9.9k

Just use fastqc to see if you even have any adapters that need trimming, and if you do, it will tell you what sequences you need to remove.

ADD COMMENT

Login before adding your answer.

Traffic: 1167 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6