Question: local blast: makeblastdb: Abort trap 6
0
gravatar for tobias.v
9 weeks ago by
tobias.v0
tobias.v0 wrote:

I am running a standalone Blast 2.6.0 on my Mac OS 10.12.2 with 1.6 Ghz intel core i5 8 GB 1600 MHz DDR3.

Everytime when I want to build a blast database with the makeblastdb command, I get the following error:

Building a new DB, current time: 01/24/2017 09:13:26 New DB name: /Users/*/bin/blast/blastdb/Cat2.fasta New DB title: Cat2.fasta Sequence type: Nucleotide Keep MBits: T Maximum file size: 1000000000B Abort trap: 6

What can I do? My file is 3.4Mb big.

I appreciate your help!

blast makeblastdb fasta • 166 views
ADD COMMENTlink modified 9 weeks ago • written 9 weeks ago by tobias.v0

Can you post your command?

ADD REPLYlink written 9 weeks ago by Buffo460

makeblastdb -in Cat19_prot.fasta -parse_seqids -dbtype prot

ADD REPLYlink written 9 weeks ago by tobias.v0

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized.

ADD REPLYlink written 9 weeks ago by genomax29k

Try this:

formatdb -i Cat19_prot.fasta -o T -p T

it produces 6 indexes, then;

blastp -query your_query.faa -db Cat19_prot.fasta -evalue 1e-5.... etc etc etc...
ADD REPLYlink written 9 weeks ago by Buffo460

next problem: formatdb command is not found...

ADD REPLYlink written 9 weeks ago by tobias.v0
1

makeblastdb is the correct command for blast+.

ADD REPLYlink written 9 weeks ago by genomax29k

I found out that formatdb is superseded by the makeblastdb command

ADD REPLYlink written 9 weeks ago by tobias.v0

Giving it a quick google, I found that such error can only be the cause of some mishandling in C++ code. Therefore, I think there might be something wrong in your input fasta file. How did you generate it?

ADD REPLYlink written 9 weeks ago by Macspider1.2k

I had an excel sheet with 3 columns: consecutive number, name of gene, sequence therefore I copied everything into a text editor and replaced all tabs with underscore, all slashes/colons with underscore etc and added a bigger than sign to the beginning, so this:

>1.gene
atgttgcaagagaaagtaaagccaatagaagaaacactcgaccccgaggattgggaatccatgcgggcactcggtcatcggatggttgacgacatgttaacatacctacggaatgtacgatccgaaccatcaggttctcccacccaaaaagccatcgaggatatttgcgttcctcttacacacgacggggaaggcgaagagaaagtttacgaggtattccaacatagtattctcccttatacgttttcaatcacgaggcctcggttttggggactagttgccggaaccggctccccatatgggatgttcgctgagatgctaagagcgggtatgaacagttgccaagaaagccttttcgcagaagcatatgtccacaagcaggtaatcggctggattaaggagatggtcgacttccccgaagaggctggcggagtactcgtaagcggtggctcagaggctaatttcaccggattagccgttgctcgaaataca

so it should be formatted as a fasta file

I also performed all search+replace commands with two other files of the same structure and there were no problems with the makeblastdb command

ADD REPLYlink modified 9 weeks ago by genomax29k • written 9 weeks ago by tobias.v0
1

I have formatted your code correctly. In future use the icon shown below (after highlighting the text you want to format as code) when editing (Screenshot courtsey of @Wouter).

ScreenCap

ADD REPLYlink written 9 weeks ago by genomax29k

I have two concerns:

  • are you sure that what you copied from excel to a data sheet is unformatted text, without any rich text markup anywhere?
  • Did you try using uppercase sequence letters?
ADD REPLYlink modified 9 weeks ago • written 9 weeks ago by Macspider1.2k

yes it is unformatted text, also when I display invisible characters, the only invisible character is the new line feed. I did not try uppercase, because makeblastdb with lowercase letters has already worked

---edit--- I found out that I only get that Abort trap: 6 error when I add the flag -parse_seqids

ADD REPLYlink modified 9 weeks ago • written 9 weeks ago by tobias.v0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 428 users visited in the last hour