Reads mapping to mir21a in mir-21 Knock-Out mice
0
0
Entering edit mode
3.9 years ago
gkuffel22 ▴ 70

Hoping the community can provide some insight. I manage a NGS core facility and recently did some miRNA-Seq for a user. The library kit was NEB Next Small RNA and I sequenced on the MiSeq generating 50 bp reads. Now...the user tells me that 3 of the samples are mir-21 Knock-Out mice confirmed by PCR however I get reads mapping to mir-21a in ALL of the samples. It is significantly down-regulated in the Knock-Outs but there are plenty of reads there nonetheless. Does anyone have any explanations for this, I'm at a loss.

If it helps here is the Bioinformatic pipeline I am using:

-CutAdapt to trim low quality reads and adapters -Bowtie to map to GRCm38 -HTSeq to count reads mapping to miRNAs -DESeq2 for differential expression

Thanks everyone!

miRNA Bowtie HTSeq • 977 views
ADD COMMENT
0
Entering edit mode

can you please show us a few reads mapping mir-21 ?

ADD REPLY
0
Entering edit mode

Sure, here is s screen shot from IGV.IGV_screenshot

Link: https://ibb.co/bJavtQ

ADD REPLY
0
Entering edit mode

no, I want the SAM records please, using samtools, to see the MAQs & other attributes.

ADD REPLY
0
Entering edit mode

I'm not sure how to get you a SAM record. I can get you a BAM file. The SAM file is too large for me to parse on my computer.

ADD REPLY
1
Entering edit mode

I'm not sure how to get you a SAM record. I can get you a BAM file. The SAM file is too large for me to parse on my computer.

samtools view your.bam chr123:456-789 > tmp.sam
ADD REPLY
0
Entering edit mode

Neat trick, thank you! Here is the command I used:

samtools view WKJ-14.bam 11:86,584,057-86,584,160 > tmp.sam

Here is a few lines of the output, how can I get you the whole file?

M01246:26:000000000-AYEU1:1:2111:10290:11204    16  11  86584057    255 25M *   0   0   TCAGATGAAAGATACCAAAATGTCA   FHHGGGGGGGGGGBBFFFFF3BBBB   XA:i:0  MD:Z:25 NM:i:0
M01246:26:000000000-AYEU1:1:1107:15622:22629    16  11  86584082    255 22M *   0   0   CACAGCCCATCGACTGCTGTTG  GGGGGGGGGGCFFFFFFCCCCC  XA:i:0  MD:Z:0G21   NM:i:1
M01246:26:000000000-AYEU1:1:1107:10021:18014    16  11  86584085    255 19M *   0   0   AGCCCATCGACTGCTGTTG GGGFGGGBFFFFFFBABBB XA:i:0  MD:Z:19 NM:i:0
M01246:26:000000000-AYEU1:1:2107:29215:16625    16  11  86584085    255 19M *   0   0   AGCCCATCGACTGCTGTTG GGGAGA2AFDFFFFBAAA> XA:i:0  MD:Z:19 NM:i:0
M01246:26:000000000-AYEU1:1:1106:25957:20282    16  11  86584086    255 18M *   0   0   ACCCATCGACTGCTGTTG  GGEG111@D1FFFAAAAA  XA:i:0  MD:Z:0G17   NM:i:1
M01246:26:000000000-AYEU1:1:1103:19760:9176 16  11  86584092    255 50M *   0   0   CTGGAGTACAGACGTGTGCTCACGATCTTCAACATCAGTCTGATAAGCTA  HHHHHHHHGHHHGHHHHHGHHHGHHHHHFGGGGGGGGGFFFFFFFCBAAB  XA:i:0  MD:Z:1G0A0C0T1C0T0G0T0T0G1C0A0T0G0A0G0A0T0T1A1C0A0G22   NM:i:23
M01246:26:000000000-AYEU1:1:1103:13615:18151    16  11  86584092    255 50M *   0   0   GAGTTCATGCGGGTGCTCTTCCGATCTGTCAACATCAGTCTGATAAGCTA  A1GFAB//00A00F0000000A111GEFGG3B1BB111B3BF1D311>11  XA:i:0  MD:Z:0C0G0A0C1G0C2T0T1C0C0A0T0G0A0G0A0T0T0C1A1A23   NM:i:21
M01246:26:000000000-AYEU1:1:1106:15735:4632 16  11  86584092    255 50M *   0   0   GGAGTTCGGACGTGGGCTCTTGCGATCTTCAACATCAGTCTGATAAGCTA  BA//EA//A0EFFB0000A0000A1F1D33BA131F1FFDFDD@31A1AA  XA:i:0  MD:Z:0C2C1G1T1T0T1C0C0A0T0G0A0G0A1T1A1C0A0G22   NM:i:19
M01246:26:000000000-AYEU1:1:1106:25422:20757    16  11  86584092    255 50M *   0   0   GATTTCAGACGGGTGCTCGTCCGATCTGTCAACATCAGTCTGATAAGCTA  AD121FA/AA//AA000A0E0FCE1F1DBAFGDF1GCGBDD1BFDA>>11  XA:i:0  MD:Z:0C0G0A0C1G0C0T0G0T0T1C0C0A0T0G0A1A0T0T0C1A1A23 NM:i:22
M01246:26:000000000-AYEU1:1:1107:12642:9990 16  11  86584092    255 50M *   0   0   GAGGAGTGAAGTGTGGTCTTCCGAGCTGTCAACATCAGTCTGATAAGCTA  A1B1212110B00000FB0E00B11B1B3BGGGGFGGGFFFFFFDA>>>>  XA:i:0  MD:Z:0C0G0A0C0T1C0T0G0T0T0G0C0C0A0T0G0A0G0A0T0T0C1A1A23 NM:i:24
ADD REPLY
0
Entering edit mode

I added markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button

ADD REPLY
0
Entering edit mode

When I look at the individual reads mapped to mir-21a they have MAPQs of 255 which I see from the documentation that means the mapping quality is not available.

ADD REPLY
0
Entering edit mode

I just found out that Bowtie does not report MAQ values as other aligners do. For Bowtie a MAQ of 255 simply means it is a unique alignment.

ADD REPLY
0
Entering edit mode

Pierre,

Did you get a chance to look at the SAM record?

ADD REPLY

Login before adding your answer.

Traffic: 1724 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6