blast alignemnt query coverage
0
0
Entering edit mode
6.8 years ago

Can anyone tell me the error in this command. I want to get full query coverage also with my seq. alignment and when I am using qcovs it is showing error.

blastn -db 17978_old_complete_genome -query 17978new_ol_genes.fasta -perc_identity 90 -evalue 0.0001 -qcovs -outfmt 6  > complete_genome_0.0001_oneline_output_qcovs
blast • 4.1k views
ADD COMMENT
2
Entering edit mode

Just try the same command with quotes The command string needs these quotes, such that the command line looks like:

blastn -outfmt "6 qcovs" ...
ADD REPLY
0
Entering edit mode

Thanks ..it works but which coloumn gives query coverage

ADD REPLY
1
Entering edit mode

why don't you upload your results.. at-least first 10 lines

ADD REPLY
1
Entering edit mode

Output should be in the same order as what you specified in -outfmt 6 "sseqid qseq qcovs sseq" gives you

gi|672239066|ref|NR_125655.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|631253076|ref|NR_114274.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|636560310|ref|NR_116370.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|343198619|ref|NR_043083.1|   CTAAAAGTTACCCCACCGAC    2   CTAAAGGTTACCCCACCGAC
gi|343201461|ref|NR_042187.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT

Here qcovs is in column 3.

ADD REPLY
1
Entering edit mode

Why don't you state the error that you are getting while running the command

ADD REPLY

Login before adding your answer.

Traffic: 1065 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6