Question: blast alignemnt query coverage
0
gravatar for sharmatina189059
21 months ago by
United States
sharmatina18905930 wrote:

Can anyone tell me the error in this command. I want to get full query coverage also with my seq. alignment and when I am using qcovs it is showing error.

blastn -db 17978_old_complete_genome -query 17978new_ol_genes.fasta -perc_identity 90 -evalue 0.0001 -qcovs -outfmt 6  > complete_genome_0.0001_oneline_output_qcovs
blast • 1.4k views
ADD COMMENTlink modified 21 months ago by geek_y9.6k • written 21 months ago by sharmatina18905930
1

Why don't you state the error that you are getting while running the command

ADD REPLYlink written 21 months ago by Karma200
1

The pattern of somehow receiving upvotes for trivial comments continues into your new account, Mask/snijesh. If you're encouraging your colleagues to do this, as you mentioned in your previous comments, please do not do that. If not, I direct this message to the OP sharmatina189059 and ask them to use upvotes with caution and award them to posts that contribute significantly to the subject matter at hand.

ADD REPLYlink written 21 months ago by RamRS21k

I am not sure what you are worried about. I did not tell anyone to upvote my comments.

ADD REPLYlink written 21 months ago by Karma200

Not to debate semantics, but I'm not "worried" about anything.

You remarked on how Mask was your previous account (See: C: RNA-Seq or Exome Seq for Clinical data analysis ). Using the older account, you also said you'd asked your colleagues to up-vote your comments. (See: C: Getting error in running GATK (GenomeAnalysisTK-3.7)? ), which we observed as odd owing to them being up-votes to relatively trivial comments.

Here, the pattern of receiving up-votes to trivial comments continues, so I asked you if your colleagues were still doing this, or if this were a one-off occurrence (a possibility I addressed with the comment directed to /u/sharmatina189059 ).

I hope this clears stuff up for you.

ADD REPLYlink written 21 months ago by RamRS21k

I am not using the account you mentioned and I don't know who upvoted my comments here.

ADD REPLYlink written 21 months ago by Karma200

Thank you for clearing that up. New users tend to upvote any response they get, so that might be the case here.

ADD REPLYlink written 21 months ago by RamRS21k
1

Just try the same command with quotes The command string needs these quotes, such that the command line looks like:

blastn -outfmt "6 qcovs" ...
ADD REPLYlink written 21 months ago by Karma200

Thanks ..it works but which coloumn gives query coverage

ADD REPLYlink written 21 months ago by sharmatina18905930
1

why don't you upload your results.. at-least first 10 lines

ADD REPLYlink written 21 months ago by Karma200
1

Output should be in the same order as what you specified in -outfmt 6 "sseqid qseq qcovs sseq" gives you

gi|672239066|ref|NR_125655.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|631253076|ref|NR_114274.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|636560310|ref|NR_116370.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT
gi|343198619|ref|NR_043083.1|   CTAAAAGTTACCCCACCGAC    2   CTAAAGGTTACCCCACCGAC
gi|343201461|ref|NR_042187.1|   AACTGACAGTTTTAGAAACAGGACT   2   AATTGACAGTTTTAGAAATAGAACT

Here qcovs is in column 3.

ADD REPLYlink modified 21 months ago • written 21 months ago by genomax67k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 502 users visited in the last hour