Question: smRNA-seq adapter trimming cutadapt
0
gravatar for woongjaej
18 days ago by
woongjaej10
woongjaej10 wrote:

Hi, guys.

I'm having trouble using cutadapt to trim the raw read(single-end) of small RNA seq.(Illumina TruSeq) I got the index information of the adapter from the sequencing facility. So I tried to trim adapters using cutadapt like below

cutadapt -b TGGAATTCTCGGGTGCCAAGG -b AACTCCAGTCAC"$INDEX_SEQ"ATCTCGTATGCC -O 3 -m 17 -o $trimmed_fastq.gz $fastq.gz

The first adapter is Illumina Samll RNA Adapter and the second one is the adapter information including index(bold 6 bases). But the fastqc report of trimmed read gives me there's TGGAATTCTCGGGTGCCAAGG sequence still over represented~!.

So if I go cutadapt again "-b TGGAATTCTCGGGTGCCAAGG" for $trimmed_fastq.gz, then they are gone. Why doesn't cutadapt get rid of TGGAATTCTCGGGTGCCAAGG at the first time?

I'm asking this because I'm ordered to use cutadapt.... If anybody know what's going on or know how to change the option of cutadapt, please help me..

Thank you

ADD COMMENTlink written 18 days ago by woongjaej10

You should be able to see in the log file how many times it found each adapter in each position. Try to compare the two runs.

ADD REPLYlink written 18 days ago by Asaf4.6k

I tried to compare the tow runs. First trimming result tells me it trimmed for 13298819 items for the first adapter. And then second trimming tells me it trimmed for 432477 items. Doesn't this mean cutadapt failed to trim for all of the "TGGAATTCTCGGGTGCCAAGG" adapter sequences??

ADD REPLYlink written 18 days ago by woongjaej10

Looks like it. That's weird.

ADD REPLYlink written 18 days ago by Asaf4.6k

I'm ordered to use cutadapt

Nothing to say in that case.

Putting bbduk.sh from BBMap out there in case you are able to use a different program. Option to use would be literal=TGGAATTCTCGGGTGCCAAGG,AACTCCAGTCAC

ADD REPLYlink modified 18 days ago • written 18 days ago by genomax40k

Thank you genomax!

I'll try to compare results from the both. Thank you for your advice

ADD REPLYlink written 17 days ago by woongjaej10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 613 users visited in the last hour