smRNA-seq adapter trimming cutadapt
0
0
Entering edit mode
4.6 years ago
woongjaej ▴ 20

Hi, guys.

I'm having trouble using cutadapt to trim the raw read(single-end) of small RNA seq.(Illumina TruSeq) I got the index information of the adapter from the sequencing facility. So I tried to trim adapters using cutadapt like below

cutadapt -b TGGAATTCTCGGGTGCCAAGG -b AACTCCAGTCAC"$INDEX_SEQ"ATCTCGTATGCC -O 3 -m 17 -o $trimmed_fastq.gz $fastq.gz

The first adapter is Illumina Samll RNA Adapter and the second one is the adapter information including index(bold 6 bases). But the fastqc report of trimmed read gives me there's TGGAATTCTCGGGTGCCAAGG sequence still over represented~!.

So if I go cutadapt again "-b TGGAATTCTCGGGTGCCAAGG" for $trimmed_fastq.gz, then they are gone. Why doesn't cutadapt get rid of TGGAATTCTCGGGTGCCAAGG at the first time?

I'm asking this because I'm ordered to use cutadapt.... If anybody know what's going on or know how to change the option of cutadapt, please help me..

Thank you

cutadapt smRNA-seq trimming Illumina • 3.2k views
ADD COMMENT
0
Entering edit mode

You should be able to see in the log file how many times it found each adapter in each position. Try to compare the two runs.

ADD REPLY
0
Entering edit mode

I tried to compare the tow runs. First trimming result tells me it trimmed for 13298819 items for the first adapter. And then second trimming tells me it trimmed for 432477 items. Doesn't this mean cutadapt failed to trim for all of the "TGGAATTCTCGGGTGCCAAGG" adapter sequences??

ADD REPLY
0
Entering edit mode

Looks like it. That's weird.

ADD REPLY
0
Entering edit mode

I'm ordered to use cutadapt

Nothing to say in that case.

Putting bbduk.sh from BBMap out there in case you are able to use a different program. Option to use would be literal=TGGAATTCTCGGGTGCCAAGG,AACTCCAGTCAC

ADD REPLY
0
Entering edit mode

Thank you genomax!

I'll try to compare results from the both. Thank you for your advice

ADD REPLY

Login before adding your answer.

Traffic: 825 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6