prinseq error: Use of uninitialized value $qual in scalar chomp
0
0
Entering edit mode
3.6 years ago
mforthman ▴ 40

Running fastq-generated SRA files from NCBI through prinseq-lite. The program generates an error:

Use of uninitialized value $qual in scalar chomp at /apps/prinseq/0.20.4/bin/prinseq-lite.pl line 2583, <FILE> line 26875674.

It still continues on until it has finished, but clearly there is something wrong going on. Here's what comes up when I look around that line:

sed -n 26875668,26875680p ../../test_1_renamed.fastq 
CCCFFFFFHGHHHJJJJFHIJJJJJIGII@GIIIJJJJJJJJJJJIJJJJJJJJHHHHAEHFFFFFFEEEECCEDDDDCD>CDEDDDDADC
@SRR5040251.6718918/1 FCC4LTMACXX:1:1215:20679:14461 length=91
CTCCTTCCCAAAGTAGCACTTCCTTCCCTTCTCGCTACGATCAAGAGATTTAGCCATCCCTGACCGAGATCGTTGTGAACTCTGGCTTTTT
+SRR5040251.6718918/1 FCC4LTMACXX:1:1215:20679:14461 length=91
@@CFFDFFFHHGDDHIIJJJJGHGHDFHIJGIHHIIIIIEEGHIJ@HIIJHGJJJCEGHGEEHGAEHED?@BCBC?;@>CCC:AC5<BDC@
@SRR5040251.6718919/1 FCC4LTMACXX:1:1215:20521:14498 length=91
CGAAGGAAACATCATAAGAAGCATCACAAAG

One person told me that the @ character in the quality line is an invalid character. I've read elsewhere that it is a valid character, plus it occurs in lines before this and they don't thrown this error. However, I wonder if the @ character at the beginning of the quality line might be throwing the program off.

prinseq software error sequence • 1.3k views
ADD COMMENT
0
Entering edit mode

This seems to be a problem with prinseq. No error with bbduk.sh from BBMap suite.

$ bbduk.sh in=in.fq out=stdout.fq ref=adapters.fa ktrim=r
java -Djava.library.path=/../bbmap/jni/ -ea -Xmx42m -Xms42m -cp /../bbmap/current/ jgi.BBDukF in=in.fq out=stdout.fq ref=adapters.fa ktrim=r
Executing jgi.BBDukF [in=in.fq, out=stdout.fq, ref=adapters.fa, ktrim=r]
Version 37.99 [in=in.fq, out=stdout.fq, ref=adapters.fa, ktrim=r]

0.043 seconds.
Initial:
Memory: max=42m, free=29m, used=13m

Added 2970 kmers; time:         0.056 seconds.
Memory: max=42m, free=28m, used=14m

Input is being processed as unpaired
Started output streams: 0.008 seconds.
@SRR5040251.6718918/1 FCC4LTMACXX:1:1215:20679:14461 length=91
CTCCTTCCCAAAGTAGCACTTCCTTCCCTTCTCGCTACGATCAAGAGATTTAGCCATCCCTGACCGAGATCGTTGTGAACTCTGGCTTTTT
+
@@CFFDFFFHHGDDHIIJJJJGHGHDFHIJGIHHIIIIIEEGHIJ@HIIJHGJJJCEGHGEEHGAEHED?@BCBC?;@>CCC:AC5<BDC@
Processing time:                0.005 seconds.

Input:                          1 reads                 91 bases.
KTrimmed:                       0 reads (0.00%)         0 bases (0.00%)
Total Removed:                  0 reads (0.00%)         0 bases (0.00%)
Result:                         1 reads (100.00%)       91 bases (100.00%)

Time:                           0.072 seconds.
Reads Processed:           1    0.01k reads/sec
Bases Processed:          91    0.00m bases/sec
ADD REPLY
0
Entering edit mode

It's a valid quality score.

ADD REPLY

Login before adding your answer.

Traffic: 2314 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6