Question: align_and_estimate_abundance.pl (rsem-parse-alignments: /lib64/libz.so.1: version `ZLIB_1.2.3.3' not found (required by rsem-parse-alignments))
0
gravatar for nasreenbano91
4 months ago by
nasreenbano910 wrote:

Hi I am trying to estimate transcript abundance from a transcriptome generated from paired-end RNA-seq data using Trinity (using trinityrnaseq-2.2.0).

Trinity.fasta (head)

>TRINITY_DN143007_c0_g1_i1 len=314 path=[632:0-108 633:109-132 634:133-313] [-1, 632, 633, 634, -2]
TTGGGACTTTTTATCTAAAATATTTGGTGGGAAAAGAGCATATAATTCACACGTCAAAAG
TTATTAGATCAGCTGTCTTACACAGGATAAAGTTTCACATTGCCCAAAAGATTAGGAGAT
GGAATCTTGTTTATTCTATGCCTTGGCCTATGAAATTGGATGTAGTTCACAATTGGGAGG
CACACTTGCCTAGCCCACCTCCGCATTTTGTTGGTTGACCTTTGACTGTTGTGTTTCTCA
TTTCTAAAGGCATATGAAGTTATTATCCTTCTTTTTGTGCAATTTTTTCTTCTTGCACTT
CTATGTCACTGTTG
>TRINITY_DN143046_c0_g1_i1 len=322 path=[300:0-321] [-1, 300, -2]
GTTTGGACGTGTATAATGAAGGAGAAAATATTTACTAATAGAGTGACTAATAAGGATTAA
TCTAAAAAGTTAAAAAATGGAAAAAAAAAAGAATTAGAGAAAAAAAGGCTAGTTGTGTGA

The command which i am using-

/opt/HPC_Applications/trinityrnaseq-2.2.0/util/align_and_estimate_abundance.pl --seqType fq --left qf_leaf_1.fastq  --right qf_leaf_2.fastq  --transcripts Trinity_clr.fasta --output_prefix RSEM_leaf --est_method RSEM --aln_method bowtie --trinity_mode --prep_reference --output_dir align

The error is as follows:

CMD: set -o pipefail && bowtie -q --all --best --strata -m 300 --chunkmbs 512 -X 800 -S -p 4 /home/nbri/nasreen/Trinity_clr.fasta.bowtie -1 /home/nbri/nasreen/qf_leaf_1.fastq -2 /home/nbri/nasreen/qf_leaf_2.fastq | samtools view -F 4 -S -b -o RSEM_leaf.bowtie.bam -
[samopen] SAM header is present: 228505 sequences.
# reads processed: 59479280
# reads with at least one reported alignment: 42603066 (71.63%)
# reads that failed to align: 16876214 (28.37%)
Reported 58309284 paired-end alignments to 1 output stream(s)
CMD: touch RSEM_leaf.bowtie.bam.ok
CMD: rsem-calculate-expression  --paired-end   -p 4    --no-bam-output --bam RSEM_leaf.bowtie.bam /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf
rsem-parse-alignments /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf.temp/RSEM_leaf RSEM_leaf.stat/RSEM_leaf b RSEM_leaf.bowtie.bam -t 3 -tag XM
rsem-parse-alignments: /lib64/libz.so.1: version `ZLIB_1.2.3.3' not found (required by rsem-parse-alignments)
"rsem-parse-alignments /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf.temp/RSEM_leaf RSEM_leaf.stat/RSEM_leaf b RSEM_leaf.bowtie.bam -t 3 -tag XM" failed! Plase check if you provide correct parameters/options for the pipeline!

Error, cmd: rsem-calculate-expression  --paired-end   -p 4    --no-bam-output --bam RSEM_leaf.bowtie.bam /home/nbri/nasreen/Trinity_clr.fasta.RSEM RSEM_leaf  died with ret: 65280 at /opt/HPC_Applications/trinityrnaseq-2.2.0/util/align_and_estimate_abundance.pl line 743.

would greatly appreciate any insight on what might be going wrong. Thanks Nasreen

ADD COMMENTlink modified 4 months ago by Alex Reynolds25k • written 4 months ago by nasreenbano910

What type/flavor/version of Linux are you using?

ADD REPLYlink written 4 months ago by Alex Reynolds25k

i am using-

x86_64 x86_64 x86_64 GNU/Linux

CentOS release 6.5 (Final)

ADD REPLYlink modified 4 months ago • written 4 months ago by nasreenbano910

Cool. Can you open up a terminal session and try the following?

$ sudo yum install zlib-devel

This should help install libz-related ("zlib") libraries. Once you have this installed, you might try re-running things and see if you get the same error.

ADD REPLYlink written 4 months ago by Alex Reynolds25k

i have tried but sudo command does not run in this linux system.

is there another command to install zlib-devel?

ADD REPLYlink written 4 months ago by nasreenbano910

[sudo] password for nbri:

when i am giving password then below statements are coming-

nbri is not in the sudoers file. This incident will be reported.

ADD REPLYlink written 4 months ago by nasreenbano910

If you need to install these libraries, you'll either need to get administrator access to your workstation (i.e., be added to the sudo'ers list by whomever administers your workstation), or you need to contact your technical support to install this package for you, as support will have that level of access.

ADD REPLYlink modified 4 months ago • written 4 months ago by Alex Reynolds25k

Perhaps another option, which does not involve a local installation of Trinity: https://github.com/trinityrnaseq/trinityrnaseq/wiki/Accessing-Trinity-on-Publicly-Available-Compute-Resources

But if you need this installed locally, there's just no way around installing its library prerequisites.

ADD REPLYlink modified 4 months ago • written 4 months ago by Alex Reynolds25k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 624 users visited in the last hour