Question: problem in running cutadapt on multiple cores
0
gravatar for Javad
24 months ago by
Javad90
Javad90 wrote:

Dear all,

I am trying to use cutadadpt for trimming adapters. It works perfectly when I run it on single core but when I try to use it on multiple cores I get the following error.

ERROR: Traceback (most recent call last):
  File "/home/user/.local/lib/python3.6/site-packages/cutadapt/pipeline.py", line 445, in run
    output.buffer.name = self._orig_outfiles.out.name
AttributeError: 'BZ2File' object has no attribute 'name'

Traceback (most recent call last):
  File "/usr/local/bin/cutadapt", line 11, in <module>
    sys.exit(main())
  File "/home/user/.local/lib/python3.6/site-packages/cutadapt/__main__.py", line 747, in main
    stats = runner.run()
  File "/home/use/.local/lib/python3.6/site-packages/cutadapt/pipeline.py", line 637, in run
    raise e
AttributeError: 'BZ2File' object has no attribute 'name'

I would really appreciate any suggestions.

Thanks

rna-seq • 1.2k views
ADD COMMENTlink written 24 months ago by Javad90
1

It looks like multithreaded trimming only works for gzipped files at the moment. I would suggest that you post a bug report on github, since perhaps the authors can simply program around this.

ADD REPLYlink written 24 months ago by Devon Ryan95k

Can you share the 2 commands you’re using?

ADD REPLYlink written 24 months ago by Joe16k

Hello,

Here it is:

This one works:

cutadapt -u 15 -U 5 -m 20 -g GATGGTTGAGGATGTGTGGAG -G GATGGTTGAGGATGTGTGGAG -g TCCACACATCCTCAACCATC -G CTCCACACATCCTCAACCATC -q 25 -o out_R1.fq.bz2 -p out_R2.fq.bz2 /path/to/file/input_R1.fq.bz2 /path/to/file/input_R2.fq.bz2

and this one doesn't:

cutadapt -j 40 -u 15 -U 5 -m 20 -g GATGGTTGAGGATGTGTGGAG -G GATGGTTGAGGATGTGTGGAG -g TCCACACATCCTCAACCATC -G CTCCACACATCCTCAACCATC -q 25 -o out_R1.fq.bz2 -p out_R2.fq.bz2 /path/to/file/input_R1.fq.bz2 /path/to/file/input_R2.fq.bz2

python --version
Python 3.6.4 :: Anaconda, Inc.

cutadapt --version
1.16
ADD REPLYlink written 24 months ago by Javad90

How many cpu threads are available to you? Do you really have 40?

Ensure you’re following all the suggestions here:

http://cutadapt.readthedocs.io/en/stable/guide.html#multi-core-support

ADD REPLYlink modified 24 months ago • written 24 months ago by Joe16k

Yes. I have 40 cores.

ADD REPLYlink written 24 months ago by Javad90

What happens if you try it with, more than 1 but less than 40? Same error?

ADD REPLYlink written 24 months ago by Joe16k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1257 users visited in the last hour