Question: Include STOP codon in getorf output
0
gravatar for lokdeep17
7 months ago by
lokdeep170
lokdeep170 wrote:

I am using getorf from EMBOSS. I want to include the STOP codon in my output file in the nucleotide format. But no matter what I try, the output is without STOP codon. Any suggestions? Example: My input file (named as input.fa) is:

>a
TAGATCCTTTCTTTCTTGTCTCTATATTACAAGGGAGTACAAAAAAGGATTATGAATATATGAAAAGAAAATTTTGAAGATAAATAAAACGGCAATTTACGTACCTAGAACAATGGCAGGACGTACTCAGGCCCTGTCCCAATCAAACATGCCATGCACATACATCTATTCTTGAAATCTCAAGGGAGACTATTTTCTAAAAAGCACCAGATTTTTTCAATTGAACATAACAGGCAACAAATGGAATAGCAAATCCAACAGCGAAGAACCCAAAATGAGAAAGAGCATAGGGCGTCTTTCTACCTTTGACTTTGAATGGAATATTCTCATACACACCATCTTTGAAATGGACTGATCTCTTCATGATAATTGGTCTAGCCATAATATTGCTACTTCTCTTTGCTGCGGTTCTAATCATTTGTTGGCACAACATTGTGTATTGAGTATGACTTCTTCTCTATTTAATTGATATGTTGTATGCTTTCTTGAAATCAGTAGACTATAAGATCGTTCTTGTAAATCATTAATCTAACCTTATGAGTTATGCTGTGGTCAATCTTTATTTTCTGTTTTTCTTGATCCCCTAGCTCTTCCGTAAACACCGAACACTTTCTCTCACATGATTGGTGCAAA

output file looks like (named as longest.fa) :

>a_3 [433 - 200] (REVERSE SENSE) 
ATGTTGTGCCAACAAATGATTAGAACCGCAGCAAAGAGAAGTAGCAATATTATGGCTAGA
CCAATTATCATGAAGAGATCAGTCCATTTCAAAGATGGTGTGTATGAGAATATTCCATTC
AAAGTCAAAGGTAGAAAGACGCCCTATGCTCTTTCTCATTTTGGGTTCTTCGCTGTTGGA
TTTGCTATTCCATTTGTTGCCTGTTATGTTCAATTGAAAAAATCTGGTGCTTTT

as you can see, this does not have a stop codon in the end. the command that I used is: hmmer2go getorf -i input.fa -o longest.fa -t3 I want stop codon to be included.

stop getorf emboss orf • 282 views
ADD COMMENTlink modified 5 months ago by Biostar ♦♦ 20 • written 7 months ago by lokdeep170
hmmer2go getorf --man

Does it have such option?

ADD REPLYlink written 7 months ago by 5heikki8.5k

I couldn't either. Weird they didn't give the option

ADD REPLYlink written 7 months ago by Asaf6.1k

I doubt many people use it for protein prediction these days..

ADD REPLYlink written 7 months ago by 5heikki8.5k

If there's some other ORF finder to do this job, please suggest it to me.

ADD REPLYlink written 7 months ago by lokdeep170

I haven't done this for quite a few years, but back then I swore by https://github.com/hyattpd/Prodigal

ADD REPLYlink written 7 months ago by 5heikki8.5k

are you looking for true ORFs as in genes or simply ORFs between two stopcodons?

Perhaps get_longest_orf, TransDecoder, FrameD, ... can be of use (most will look for true genes though)

ADD REPLYlink written 7 months ago by lieven.sterck5.8k

I tried get_longest_orf.pl, it also does not include STOP codon in the output.

ADD REPLYlink written 7 months ago by lokdeep170
1

you are correct. and as it turns out it itself is based on EMBOSS so to be expected behavior (and thus my bad to list that one)

ADD REPLYlink modified 5 months ago • written 7 months ago by lieven.sterck5.8k

Prodigal is a great tool but for microbes.

ADD REPLYlink written 7 months ago by Asaf6.1k

Why do you think it's just for microbes?

-g:  Specify a translation table to use (default 11).
ADD REPLYlink written 5 months ago by 5heikki8.5k

It's not just the translation table, it's identifying TSS and other stuff. Take a look at the paper

ADD REPLYlink written 5 months ago by Asaf6.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 777 users visited in the last hour