Question: What is the right illumina universal adapter sequence for trimming paired-end reads?
gravatar for maria2019
22 months ago by
maria2019130 wrote:

I have paired-end WES reads and FastQC report shows adapter content error “Illumina Universal adaptor”. I read the Adapter_list.txt in the fastQC folder which says that the Illumina universal adapter can be summarized in the 12 bp fragment of AGATCGGAAGAG.

My question is should I use this sequence (AGATCGGAAGAG) for both forward and reverse reads? or I should make a complementary sequence of CTCTTCCGATCT for the reverse read?

cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq


cutadapt -a AGATCGGAAGAG -A CTCTTCCGATCT -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq


fastqc wes trimadaptor • 7.3k views
ADD COMMENTlink modified 22 months ago by lakhujanivijay5.3k • written 22 months ago by maria2019130
gravatar for lakhujanivijay
22 months ago by
lakhujanivijay5.3k wrote:

The answer is

cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG -o tr_R1.fastq -p tr_R2.fastq R1.fastq R2.fastq

You can use the same sequence. I think you should also check the trimming report, read 1 and read 2 should have similar stats.

ADD COMMENTlink written 22 months ago by lakhujanivijay5.3k

Thank you for your answer. I have tried both ways and then I see a good fastQC result with either of them! That is why I am not sure if I should just keep the first one or dig into it and find out which one is better.

What would be the good comparison point to decide which one to use?

ADD REPLYlink modified 22 months ago • written 22 months ago by maria2019130

can you post the fastqc images here?

ADD REPLYlink written 22 months ago by lakhujanivijay5.3k

Does cutadapt remove the sequence you put in and its reverse complement (+ to the end of the read) from every string in the fastq file?

ADD REPLYlink written 21 months ago by cristian260

I think it too short to use only 12 nt sequence to trim adapter. fastp gives Illumina universal adapter for both reads, reads 1 is _AGATCGGAAGAGCACACGTCTGAACTCCAGTCA_ and reads 2 is _AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT_

ADD REPLYlink written 3 months ago by MatthewP840
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1237 users visited in the last hour