extract discordant,split reads from BAM file
1
0
Entering edit mode
2.8 years ago
9521ljh ▴ 50

DNA sequencing data

i want to identify the sequence of fusion gene.

for example, some fusion algorithm gave me A(gene) and B(gene') are fusion.

Thus, i use the samblaster which input is BAM file and the output gave me discordant.sam file

(e.g.)

HWI-ST482:143548235:C2TWGACXX:4:1215:5836:43786 145 9   66784609        0       100M    =       66784611        -98     CTCCTTCGTTGGAAACGAGAGTATTTTCACTTAAACACTAGACAGAAGCATTCTCAGAAACTAATTTGTGATGTGTGCATTCAACTCACAGAGTTCAACC    DB@BD@B>3EDDFFEHHJJGJJJJHHEC=GGJHGCIIIIGHEIJIIIHAEHDHCFJIIHGIJJJJJJIIIHCJGIIIIHBIJIHIJIFHHHHDFFFF@C@ RG:Z:2893812918 PG:Z:2893812918 XT:A:R  NM:i:2  SM:i:0  AM:i:0  X0:i:2  X1:i:0  XM:i:2  XO:i:0  XG:i:0  MD:Z:0G0G98     XA:Z:9,-69977247,100M,2;
HWI-ST444:143456288:C2U55ACXX:5:1308:19664:33640    81  13      69979245        37      100M    =       69979245        -100    TGGACTTTCTGAATGTAATAGTTAACTGGTTCTTCAATTGTTTTAATAAAACCTTTCTCATTCAAATTCATTTTAAAGATTCAAACAGGAGTTTAAACAG    ECC@EEFFDFFFFHHHHHHHJJIJJJJJJJJIGIIJJJJIIJIIIIGHHFBHGJJJJJJJJJJJJJJJIJIHGJJJJJJJJIHIHJJHHGHHFFFFFCBB RG:Z:2893805527 PG:Z:2893805527 XT:A:U  NM:i:0  SM:i:37 AM:i:37 X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:100
HWI-ST444:143456288:C2U55ACXX:5:1308:19664:33640    161 13      69979245        37      100M    =       69979245        100     TGGACTTTCTGAATGTAATAGTTAACTGGTTCTTCAATTGTTTTAATAAAACCTTTCTCATTCAAATTCATTTTAAAGATTCAAACAGGAGTTTAAACAG    CCCFFFFFHHGHHJJGHIJJJIJJJJJJJHCHIJJIJIIJ@GHJIJJJIIIIJIJIIGIJJIJJIJJGJJIIJIIIJHIIJIJJJJGHHFFDFFEFEEEE RG:Z:2893805527 PG:Z:2893805527 XT:A:U  NM:i:0  SM:i:37 AM:i:37 X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:100

But how to know this reads are mapped to A(gene) and B(gene')

next-gen sequencing sequence • 1.4k views
ADD COMMENT
0
Entering edit mode

Please use the formatting bar (especially the code option) to present your post better. I've done it for you this time.
code_formatting

Thank you!

ADD REPLY
0
Entering edit mode
2.8 years ago
h.mon 34k

You may want to look at the bedtools intersect documentation.

ADD COMMENT

Login before adding your answer.

Traffic: 897 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6