Question: Excessive data loss after trimming
0
gravatar for jomagrax
8 months ago by
jomagrax30
Spain
jomagrax30 wrote:

Hi everyone!

I am trimming the adapters of my data, for one of the controls cutadapt It's only keeping the 5.2% of the reads after trimming and removing reads shorter than 17bp

$ cutadapt -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -j 4  -m 17 -o control_2_trimmed.fastq control_2.fastq

=== Summary ===

Total reads processed:               5,252,641
Reads with adapters:                 5,169,644 (98.4%)
Reads that were too short:           4,981,734 (94.8%)
Reads written (passing filters):       270,907 (5.2%)

Total basepairs processed:   262,632,050 bp
Total written (filtered):      8,801,796 bp (3.4%)

While for the other samples values around 40% are obtained. Is the problem somehow my foult or coud It be from the data?

Thank you in advance, Jose

rna-seq genome • 232 views
ADD COMMENTlink written 8 months ago by jomagrax30
2

Looks to me like library prep was screwed up and you got primer dimer, can you get a hold on the library QC (pre-sequencing)? Maybe other people with some more experience can comment

ADD REPLYlink written 8 months ago by Asaf8.4k

Can you try removing minimum length filter -m 17? Though it doesn't help much, but you would know number reads without any length filter in this file. As Asaf pointed, try reaching sequencing core @ jomagrax

ADD REPLYlink written 8 months ago by cpad011214k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1152 users visited in the last hour