ImportError: No module named cutadapt.scripts
0
0
Entering edit mode
4.4 years ago
jomagrax ▴ 40

Hi everyone Im using cutadapt 1.18, I have installed it from conda (I think, Im using CAP-miRSeq and It requires a lot of programs and Im kind of lost). Python version Python 2.7.15 :: Anaconda, Inc.

when I run cutadapt I find this problem

 /home/superuser/CAP-miRSEQ/bin/cutadapt -b AATCTCGTATGCCGTCTTCTGCTTGC -O 3 -m 17 -f fastq -q 20 /home/superuser/CAP-miRSEQ/sample_data/SRR326279_R1.fastq -o /home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.cutadapt.fastq --too-short-output=/home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.tooshort.fastq
Traceback (most recent call last):
  File "/home/superuser/CAP-miRSEQ/bin/cutadapt", line 9, in <module>
    from cutadapt.scripts import cutadapt
ImportError: No module named cutadapt.scripts
(base)

Im very new to bioinformatics so any help would be great.

Thankyou in advance, Jose

rna-seq cutadapt cap-mirseq • 1.6k views
ADD COMMENT
0
Entering edit mode

This does not look like a path to a conda installation. How exactly did you install it (add commands please)?

ADD REPLY
0
Entering edit mode
ADD REPLY

Login before adding your answer.

Traffic: 2092 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6