Question: ImportError: No module named cutadapt.scripts
0
gravatar for jomagrax
28 days ago by
jomagrax20
Spain
jomagrax20 wrote:

Hi everyone Im using cutadapt 1.18, I have installed it from conda (I think, Im using CAP-miRSeq and It requires a lot of programs and Im kind of lost). Python version Python 2.7.15 :: Anaconda, Inc.

when I run cutadapt I find this problem

 /home/superuser/CAP-miRSEQ/bin/cutadapt -b AATCTCGTATGCCGTCTTCTGCTTGC -O 3 -m 17 -f fastq -q 20 /home/superuser/CAP-miRSEQ/sample_data/SRR326279_R1.fastq -o /home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.cutadapt.fastq --too-short-output=/home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.tooshort.fastq
Traceback (most recent call last):
  File "/home/superuser/CAP-miRSEQ/bin/cutadapt", line 9, in <module>
    from cutadapt.scripts import cutadapt
ImportError: No module named cutadapt.scripts
(base)

Im very new to bioinformatics so any help would be great.

Thankyou in advance, Jose

cutadapt rna-seq cap-mirseq • 107 views
ADD COMMENTlink written 28 days ago by jomagrax20

This does not look like a path to a conda installation. How exactly did you install it (add commands please)?

ADD REPLYlink written 28 days ago by ATpoint29k

I think cutadapt is on python3 now: https://cutadapt.readthedocs.io/en/stable/installation.html

ADD REPLYlink written 27 days ago by curious210
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 795 users visited in the last hour