Question: ImportError: No module named cutadapt.scripts
0
gravatar for jomagrax
8 months ago by
jomagrax30
Spain
jomagrax30 wrote:

Hi everyone Im using cutadapt 1.18, I have installed it from conda (I think, Im using CAP-miRSeq and It requires a lot of programs and Im kind of lost). Python version Python 2.7.15 :: Anaconda, Inc.

when I run cutadapt I find this problem

 /home/superuser/CAP-miRSEQ/bin/cutadapt -b AATCTCGTATGCCGTCTTCTGCTTGC -O 3 -m 17 -f fastq -q 20 /home/superuser/CAP-miRSEQ/sample_data/SRR326279_R1.fastq -o /home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.cutadapt.fastq --too-short-output=/home/superuser/CAP-miRSEQ/sample_output/fastqs//SRR326279.tooshort.fastq
Traceback (most recent call last):
  File "/home/superuser/CAP-miRSEQ/bin/cutadapt", line 9, in <module>
    from cutadapt.scripts import cutadapt
ImportError: No module named cutadapt.scripts
(base)

Im very new to bioinformatics so any help would be great.

Thankyou in advance, Jose

cutadapt rna-seq cap-mirseq • 430 views
ADD COMMENTlink written 8 months ago by jomagrax30

This does not look like a path to a conda installation. How exactly did you install it (add commands please)?

ADD REPLYlink written 8 months ago by ATpoint38k

I think cutadapt is on python3 now: https://cutadapt.readthedocs.io/en/stable/installation.html

ADD REPLYlink written 8 months ago by curious440
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1158 users visited in the last hour