Dear all Can someone tell me how to retrieve multi-line fasta file from for instance below mentioned data using a list of locus_tag like locus_tag=ABUW_RS00010, locus_tag=ABUW_RS00015. I have 400 entries of this.
>lcl|NZ_CP008706.1_cds_WP_001237350.1_2 [locus_tag=ABUW_RS00010] [protein=DNA polymerase III subunit beta] [protein_id=WP_001237350.1] [location=1590..2738] [gbkey=CDS]
GTGCGTTTGAAAATCGCTAAAGAAAGTTTACTCAATGTTTTATCGCATGTGGTCGGTGCGGTAGAACGTC
GTCATACCTTGAATATTCTTTCAAACGTCAAAATTCAGACTAATGCTCAAGCGCTCACTATTACGGGTTC
>lcl|NZ_CP008706.1_cds_WP_000550807.1_3 [locus_tag=ABUW_RS00015] [protein=DNA replication/repair protein RecF] [protein_id=WP_000550807.1] [location=2753..3835] [gbkey=CDS]
ATGCATCTTACGCGCTTAAATATTGAACGTGTGCGTAATTTAAAAACGGTTGCACTCCATGGGTTGCAAC
CGTTTAATGTCTTTTATGGCGCAAACGGTTCGGGTAAAACATCAATTTTAGAAGCGATCCATTTGCTTGC
AACAGGTCGCTCATTCCGTACACATATACCCAAAAATTATATTCAATATGAAGCTGACGACGCGATTGTA
TTTGCTCAGTCAGCAACTGAAAAAATTGGTATGCAAAAACTCGCTTCTGGTGAGCAACTCATGAAAGTGA

Hello sharmatina189059,
could you please reformat your post using the code button (the one with 101010) so that one can see how your input file realy looks like.
Does it look like this?
fin swimmer
retrieve from where?
I added markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below: