Turn Off Blast Search On Reverse Complement Strand In Blastn
Entering edit mode
12.8 years ago
Zhaorong ★ 1.4k

I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?

For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query.

Maybe I missed it when I read the man page, but I really appreciate it if someone can point out the parameter I should use.


sequence blast • 58k views
Entering edit mode

I think you should someone take care of the target or subject strandedness as well. You should post - filter the results based on the alignment location I guess in query and subject/ target

Entering edit mode
12.8 years ago

The -S flag can select the strands:

-S  Query strands to search against database 
    (for blast[nx], and tblastx) 3 is both, 1 is top, 2 is bottom [Integer]
Entering edit mode

In NCBI BLAST+ this is controlled by the '-strand' option.

Entering edit mode
10.5 years ago
kevin.l.neff ▴ 330

For BLAST+, it's -strand {both,plus,minus}

Entering edit mode

I'm not sure this option even works because it's giving me identical results for plus and minus.


Login before adding your answer.

Traffic: 845 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6