Question: Turn Off Blast Search On Reverse Complement Strand In Blastn
6
gravatar for Zhaorong
9.9 years ago by
Zhaorong1.2k
State College, PA
Zhaorong1.2k wrote:

I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?

For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query.

Maybe I missed it when I read the man page, but I really appreciate it if someone can point out the parameter I should use.

Thanks!

sequence blast • 55k views
ADD COMMENTlink modified 9.9 years ago by kevin.l.neff240 • written 9.9 years ago by Zhaorong1.2k
4
gravatar for Istvan Albert
9.9 years ago by
Istvan Albert ♦♦ 82k
University Park, USA
Istvan Albert ♦♦ 82k wrote:

The -S flag can select the strands:

-S  Query strands to search against database 
    (for blast[nx], and tblastx) 3 is both, 1 is top, 2 is bottom [Integer]
ADD COMMENTlink modified 5 months ago by RamRS25k • written 9.9 years ago by Istvan Albert ♦♦ 82k
4

In NCBI BLAST+ this is controlled by the '-strand' option.

ADD REPLYlink written 7.9 years ago by Hamish3.1k
1
gravatar for kevin.l.neff
7.6 years ago by
kevin.l.neff240
Mayo Clinic College of Medicine
kevin.l.neff240 wrote:

For BLAST+, it's -strand {both,plus,minus}

ADD COMMENTlink written 7.6 years ago by kevin.l.neff240

I'm not sure this option even works because it's giving me identical results for plus and minus.

ADD REPLYlink written 7.6 years ago by kevin.l.neff240
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 852 users visited in the last hour