Turn Off Blast Search On Reverse Complement Strand In Blastn
3
7
Entering edit mode
11.2 years ago
Zhaorong ★ 1.3k

I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?

For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query.

Maybe I missed it when I read the man page, but I really appreciate it if someone can point out the parameter I should use.

Thanks!

sequence blast • 56k views
ADD COMMENT
0
Entering edit mode

I think you should someone take care of the target or subject strandedness as well. You should post - filter the results based on the alignment location I guess in query and subject/ target

ADD REPLY
4
Entering edit mode
11.2 years ago

The -S flag can select the strands:

-S  Query strands to search against database 
    (for blast[nx], and tblastx) 3 is both, 1 is top, 2 is bottom [Integer]
ADD COMMENT
4
Entering edit mode

In NCBI BLAST+ this is controlled by the '-strand' option.

ADD REPLY
2
Entering edit mode
8.8 years ago
kevin.l.neff ▴ 280

For BLAST+, it's -strand {both,plus,minus}

ADD COMMENT
0
Entering edit mode

I'm not sure this option even works because it's giving me identical results for plus and minus.

ADD REPLY

Login before adding your answer.

Traffic: 2440 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6