Question: Turn Off Blast Search On Reverse Complement Strand In Blastn
7
gravatar for Zhaorong
10.9 years ago by
Zhaorong1.3k
State College, PA
Zhaorong1.3k wrote:

I have a quick question: How can I turn off search on reverse complement strand of my query nucleotide sequence in blastn?

For example, I don't want 'GUAAAGCCAAAUCUUCGGUUA' to be a hit when I use 'UAACCGAAGAUUUGGCUUUAC' as the query.

Maybe I missed it when I read the man page, but I really appreciate it if someone can point out the parameter I should use.

Thanks!

sequence blast • 56k views
ADD COMMENTlink modified 5 months ago by yasopi95680 • written 10.9 years ago by Zhaorong1.3k

I think you should someone take care of the target or subject strandedness as well. You should post - filter the results based on the alignment location I guess in query and subject/ target

ADD REPLYlink written 5 months ago by jayeshkumarsundaram0
4
gravatar for Istvan Albert
10.9 years ago by
Istvan Albert ♦♦ 86k
University Park, USA
Istvan Albert ♦♦ 86k wrote:

The -S flag can select the strands:

-S  Query strands to search against database 
    (for blast[nx], and tblastx) 3 is both, 1 is top, 2 is bottom [Integer]
ADD COMMENTlink modified 17 months ago by _r_am32k • written 10.9 years ago by Istvan Albert ♦♦ 86k
4

In NCBI BLAST+ this is controlled by the '-strand' option.

ADD REPLYlink written 8.9 years ago by Hamish3.2k
2
gravatar for kevin.l.neff
8.6 years ago by
kevin.l.neff280
Mayo Clinic College of Medicine
kevin.l.neff280 wrote:

For BLAST+, it's -strand {both,plus,minus}

ADD COMMENTlink written 8.6 years ago by kevin.l.neff280

I'm not sure this option even works because it's giving me identical results for plus and minus.

ADD REPLYlink written 8.6 years ago by kevin.l.neff280
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1484 users visited in the last hour