Aligning Miseq With Deletions >10 Bases
0
2
Entering edit mode
11.1 years ago
Leszek 4.2k

We expect deletions (10-1000 bases) in the genome of interest, therefore, we run paired MiSeq 300bp+200bp. Can you recommend me the best aligner for such dataset?
In theory, some programs should handle it right:

  • bowtie2 supports gapped alignments in end-to-end mode, but in practice I haven't seen big indels
  • bwa aln - there are -o and -e parameters, anyone tried it?
  • bwa bwasw - align reads with deletion twice: up- and downstream from the deletion, the other part of the read is clipped.
  • blat - slow and reports multiple suboptimal hits, plus no SAM output
  • any other recommendations?

What is your opinion?

EDIT
Just to make it clear, pairs are overlapping, after merging with FLASH I get single reads ~400 bases.

example:


@M00724:10:000000000-A2EKA:1:1101:16915:1666 1:N:0:1
TTATCTTGAAAAAATGCACCCGCAGCTTCGCTCGTAATCCGAAAACACGGGAAATGGAGTCAGGCTTTTTTTATGGATGAGAAAATAGACACCAAAGAAGCCTTCATATGACCTTAACGGACCTACAATGCAAAAAGTTATCAAAAGACTGCATTATTGAGCACACATAGTACTAATAAAGTAATCTAAGAAGCGTGGTTAGAAAGATAGCGATCTCGTGATGCATTTTTGTAGAACAAAAAAGAATTAGAGATTCTTTGTTGGTAAAATAGCTCTCTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGATCTGATTCTTTGTATGAACAAGTAGCGCTCTCGCGTTGCATTTTTGTTCTACAAAATGAAGCAAAGATGCTTCGTTAACAAAGATATGCTATTGAAGTGCAAGTT
+
5<=,<>>/----5+<-ACC8+>+>>+8C.++7++>+,78.++55>-+,5**+5+------5----5-5CE))4=+4++4+4+4++++44@+11*1***3**;38@*1****11*1*0191:)-./6?(666(6?6(-(/(.((6((./((((../66((((/((./((.(./((/(((((//6<ee;?=(6((.' ('="" (="" (="" .6(6<(.(''(="" 66##(="" ;6;6ee="?;(&lt;;###./(///#(#(#(/(6#6(;..(&lt;=&lt;;/6/6&lt;#6///(#)98/#8*@23*#&lt;*;3#?&lt;4#24+&lt;#4+++C6++4++++6++++D=C56,,,56+-A)DC5*5***C*C+E-FCC7+,EEEEAD9A7...99.AD.A.9.A-9-">+A7+9/AEA8//AC/C@C;>9<-5-5-->
should align to 2-micron plasmid of S. cerevisiae with one deletion of 125 bases (blat .psl output)
380    35    0    0    0    0    1    125    +    M00724:10:000000000-A2EKA:1:1101:16915:1666    415    0    415    2-micron    6318    3937    4477    2    59,356,    0,59,    3937,4121,
alignment miseq next-gen • 3.3k views
ADD COMMENT
1
Entering edit mode

Try: "bwa bwasw -b9 -q16 -r1 -w200". Let me know what you get. Thanks.

ADD REPLY
1
Entering edit mode

I will be curious to see how BWA works on such long reads.

ADD REPLY
1
Entering edit mode

It is bwa-sw, not bwa. Bwa-sw is known to work with 150kb BACs and even 1Mbp sequences.

ADD REPLY
1
Entering edit mode

BWA-SW does not work with PE? Unless it is being used after joining reads with FLASH?

ADD REPLY
1
Entering edit mode

It has been working with PE for a year or so.

ADD REPLY
1
Entering edit mode

it splits correct alignments obtained with default parameters. the reads with deletions are aligned twice: upstream and downstream from the deletion, the other part of the read is clipped.

ADD REPLY
1
Entering edit mode

That is exactly why I was asking you to use the non-default parameters. You will get longer deletions, though not longer than half of read length. As you are working on small genomes, why not de novo assemble your reads first?

ADD REPLY

Login before adding your answer.

Traffic: 2761 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6