Where Can I Download All Exons Of The Human Genome In Fasta Format (One Big File!) ?
5
4
Entering edit mode
8.6 years ago
mariusorion ▴ 60

Hi to all,

Where can I download all exons of the human genome in FASTA format (one big file!) ?

thanks.

exon exon human genome fasta download • 11k views
ADD COMMENT
0
Entering edit mode

Thank you very much to all. Thank you Malachi, this is what I am looking for.

ADD REPLY
0
Entering edit mode

Not an answer... This should go as a comment. Thanks!

ADD REPLY
0
Entering edit mode
ADD REPLY
9
Entering edit mode
8.5 years ago

Using Ensembl BioMART

  1. Go to BioMART website.
  2. Choose database: Ensembl Genes 70
  3. Choose dataset: Homo sapiens
  4. Click 'Attributes' then select the 'Sequences' option
  5. Expand the sequences pane and select the 'Exon sequences' option
  6. Expand the 'Header information' pane. Select the info you want to associate with each sequence record (e.g. Ensembl Gene ID, Ensembl Transcript ID, Ensembl Exon ID).
  7. Click the 'Results' button.
  8. Make sure the example output looks good, select the 'Compressed File' option and hit the 'Go' button.

The download took a while but eventually I got a file 'mart_export.txt.gz'. This file has output that looks like this

>ENSG00000264715|ENST00000578347|ENSE00002715610
AGGAGTGACCAGAAGACAAGAGTGCGAGCCTTCTGTTATGCCCAGACAGGGCCACCAGAGGGCTCCTTGGTCTAGTGGTAACGCCA 
>ENSG00000265161|ENST00000580394|ENSE00002716056
AGTAGAGATGGGGTTTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATCCATCCACC
>ENSG00000200917|ENST00000364047|ENSE00001438810
GCACATACATATACTAAAATTGGAACAATACAGAGAAGATTAGCATAGCCCCTGCGCAAGGATGACATGCAAATTCGTGAAGTGTTCCATATTAAA
...
ADD COMMENT
0
Entering edit mode

Thank you Malachi, this is what I am looking for :)

ADD REPLY
2
Entering edit mode
8.6 years ago
aindap ▴ 120

Have a look at the UCSC Table Browser: position base query

ADD COMMENT
0
Entering edit mode

The page does not work

ADD REPLY
0
Entering edit mode
ADD COMMENT
0
Entering edit mode
5.1 years ago

If anyone is looking for the same but for GRCh37 here is the link.

ADD COMMENT

Login before adding your answer.

Traffic: 1371 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6