Question: Question Regarding Sam Out Put
gravatar for Raghav
7.0 years ago by
Allahabad, India
Raghav100 wrote:

I used samtools view -q 255 for uniquely mapped reads and I am showing here snap short of out put,

SRR.120 0 Chr1 23593555 255 50M * 0 0 AGTAGGTCAGTCTTTGGCTTACATGAGACACATGTCCATTCATCTTCGTC __aceeccggeggiiiiiiihfhhhihiihiiihhhiiiiiiihhiiiii XA:i:0 MD:Z :50 NM:i:0

SRR.121 0 Chr5 24847592 255 50M * 0 0 AAAGATAAATGCTCTTCTCTAGTTTGTTAGATTCGATTTCTAAGTAGATC __^cccccg[^eefgfg[deghegdghhddcagfdfbgaedgghXbedec XA:i:0 MD:Z :50 NM:i:0

SRR681003.124 0 Chr1 5798964 255 50M * 0 0 ATATCTTTGTTTTTGGTTATAAATGTAAATTGTGAGACGGTGAAATTTTA bbbeeeeegggggiiigiiiiiiiihhiiiiihiiiiiiiiiihiiiiih XA:i:0 MD:Z:50 NM:i :0

SRR681003.131 0 Chr5 26785037 255 50M * 0 0 CAATCACTCGAAGTAGTAGAGACCGGTGTGCTTATGGATGGATGCAACTC bbbeeeeegggggfhigghiiiiiiidfeghiiiiiihiiihihiiihii XA:i:0 MD:Z :50 NM:i:0

SRR681003.117 0 Chr1 2106379 255 50M * 0 0 AGATGTCCAATTCTCAAAGCGTGTCGGACTTTCTACAGAACGGCCGAATG abbeeeeegggggiiiiiiiifhghiihiiiiiiiiiihiiiiiiihhhf XA:i:0 MD:Z:50 NM:i :0

SRR681003.127 0 Chr4 15955851 255 50M * 0 0 GGTTAAAATAGTCATACCCAAAAACTTGTATAAAAGCAATATAAACAAAA abaeeeeegggggiiiiiiiiiihhiiigghihhhihiiiiihiihiiih XA:i:0 MD:Z :50 NM:i:0

SRR681003.133 0 Chr3 13104556 255 50M * 0 0 AATGAAAATCCCAATCCTAACCAGAGTGCTAGCAGTATTCCCACCCATGT bbbeeeeegggggiiiiiiiiiiiiieggiiiihifghiihiefgiiihi XA:i:0 MD:Z :50 NM:i:0 SRR681003.125 16 Chr2 5090556 255 50M * 0 0 TCCAAGCTCATCCTCAAGCACTCAATCGGTTTCAAGCTCCAAATTTCATC iiiiiiiiihgiiiiiiihgihihgehiiiihiiiiigggggeeeeebbb XA:i:0 MD:Z:50 NM:i :0 SRR681003.137 16 Chr4 11285835 255 50M * 0 0 GCATGGTTGAGTTTATTGGATTGTTGAAGGTGACTATTAAAAAGGGTACC iiiiiiiiiiiiiiihiiiiiiiiiiiiiiiihiiiigggggeeeeeabb XA:i:0 MD:Z :50 NM:i:0

SRR681003.132 16 Chr2 16270291 255 50M * 0 0 CTGACATTAATATATGCAACGGGAAAGTTAAGGATACGTATATAATAATG hiiiiiiiiiiiiiiiiihiiiiiiiiiiiiiiiigigggggeeeeebbb XA:i:0 MD:Z :50 NM:i:0

SRR681003.141 16 Chr2 13408562 255 50M * 0 0 CGATAACGAGATCAATTGGGATTGGTTCAAAGTTTTCGTCGCGTCCAAGG egggggiiiihihgebbiiiiiiiiiiiiiiiiiiiigggggeeeeebbb XA:i:0 MD:Z

Question is is map quality 255 is best quality ???

is 50M is matched score or mismatched score?

what does mean by MD:Z:50 if 50M and best quality score is 255

sam • 2.3k views
ADD COMMENTlink modified 7.0 years ago by Matt Shirley9.3k • written 7.0 years ago by Raghav100
gravatar for Matt Shirley
7.0 years ago by
Matt Shirley9.3k
Cambridge, MA
Matt Shirley9.3k wrote:

In the samtools documentation you'll find that a MAPQ value of 255 indicates mapping quality is not available. The MAPQ scale is 0-63, with 63 being best. "50M" is the CIGAR string, also on page 4, and this indicates that all 50 bases match the reference in the alignment. The SAM format can be somewhat confusing, but it would really help if you either search or read the documentation for the format / tool you're using before posting a question next time.

ADD COMMENTlink modified 7.0 years ago • written 7.0 years ago by Matt Shirley9.3k

Actually, if this is output from Tophat, 255 indicates a unique alignment. Yeah, that's technically not in accordance with the SAM spec., but that's what they do.

Also, MAPQ can go up to 254 (excluding the special case of 255), though you'll never see that in practice.

ADD REPLYlink written 7.0 years ago by Devon Ryan95k

cool. I didn't know that 255 thing.

ADD REPLYlink written 7.0 years ago by Pierre Lindenbaum129k

Yes, and I think you won't encounter it too often. These traces are downloaded from the NCBI sequence read archive, where the data are curated in a very compliant manner.

ADD REPLYlink written 7.0 years ago by Matt Shirley9.3k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1053 users visited in the last hour