Single Cell Pipeline for SmartSeq

Question

[hpumut]

Dear Community,

I want to align SmartSeq platform-based single-cell data to the human genome using Alevin and/or StarSolo and then create a Seurat object. My data is paired-end. Each FASTQ file is around 4-10 GB in size.

R1 and R2 pairs look like this:

R1:

@A00814:396:HYJJ7DMXX:2:1101:1976:1000 1:N:0:TTATAACC+NCGATATC
NTCTCTGTATCAGCATATTAGCAATAACATATTTTTAAATGAAGGTATGTA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00814:396:HYJJ7DMXX:2:1101:4146:1000 1:N:0:TTATAACC+NCGATATC
NGCATCTTTATGGTGTTCTCTGTATTTCCTGAATTTGAATGTTGGCCTGCC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00814:396:HYJJ7DMXX:2:1101:5376:1000 1:N:0:TTATAACC+NCGATATC
NGGGGGGAGAGCGCGGCGACGGGTCTCGCTCCCTCGGCCCCGGGATTCGGC
+
FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF

R2:

@A00814:396:HYJJ7DMXX:2:1101:1976:1000 2:N:0:TTATAACC+NCGATATC
GGTGCACATGAAGGCTATGTTTGCACTGTATTATGGTTTAAGTGTATAATA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00814:396:HYJJ7DMXX:2:1101:4146:1000 2:N:0:TTATAACC+NCGATATC
AAACACTCTGCAGGATATTATCCAGGAGAACTTCCCCAACCTAGAAAGGCA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF,
@A00814:396:HYJJ7DMXX:2:1101:5376:1000 2:N:0:TTATAACC+NCGATATC
TACAGCCCCCCCGGCAGCAGCACTCGCCGAATCCCGGGGCCGAGGGAGCGA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

Does this data have barcodes? If yes, where is it?

TTATAACC+NCGATATC is present in all headers in the same FASTQ file. Different FASTQ files have different values at the end of the header. If TTATAACC+NCGATATC is the cell barcode, can I consider the whole FASTQ file to belong to a single cell? Or does this FASTQ file have sequence information for many cells?

I am looking forward to your assistance.

Thank you

[GenoMax]

Yes this data is indexed. Indexes are located in header. Your guess is right. For this sample the are TTATAACC+NCGATATC. These are illumina indexes and they may be for the sample. Each cell may have its own cell barcodes. They will not be in the fastq header in general.

[hpumut]

Thank you for your prompt reply. Thank you for the information that TTATAACC+NCGATATC is the index for the sample. Then, how can I obtain the cell barcode information? I do not have any extra files except R1 and R2 pairs.

Answer 1

[ATpoint]

Smartseq is plate-based and each well in the plate (=1 cell) is a fastq file pair and there are no cellular barcodes or UMIs. Hence, you don't need any specific single-cell software. You can use salmon or STAR.

[hpumut]

Thank you for your prompt reply. Each FASTQ file is around ~5 GB (uncompressed). Each FASTQ file belongs to one cell type, right? I am asking this question because I thought the size of the file is quite large for a single cell. I have 25 pairs of R1 and R2. Does it mean that I have sequencing information only for 25 cells?