Question: Understanding miRdeep2 mapper output
1
gravatar for niu2rseq
6.2 years ago by
niu2rseq70
United States
niu2rseq70 wrote:

Hello I have a miRdeep2 mapper output and I am confused by its description.

the command I ran is:

mapper.pl *S1_L001_R1_001.fastq -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p ensembl_genome.fa -s S1_reads_fastq.fa -t S1_ensembl.arf -v

The output summary file is:

mv: cannot move `mapper.log' to `mapper.log_bak': No such file or directory

parsing fastq to fasta format

converting rna to dna alphabet

discarding sequences with non-canonical letters

clipping 3' adapters

discarding short reads

collapsing reads

mapping reads to genome index

# reads processed: 64477

# reads with at least one reported alignment: 22453 (34.82%)

# reads that failed to align: 39152 (60.72%)

# reads with alignments suppressed due to -m: 2872 (4.45%)

Reported 30211 alignments to 1 output stream(s)

trimming unmapped nts in the 3' ends

cat: mapper.log_tmp: No such file or directory

cat: mapper.log_bak: No such file or directory

rm: cannot remove `mapper.log_tmp': No such file or directory

rm: cannot remove `mapper.log_bak': No such file or directory

Mapping statistics

 

#desc   total   mapped  unmapped        %mapped %unmapped

total: 1222343  1009414 212929  0.826   0.174

seq: 1222343    1009414 212929  0.826   0.174

 

What I don't understand is: the difference between

the alignment rate 

# reads with at least one reported alignment: 22453 (34.82%)

# reads that failed to align: 39152 (60.72%) 

and 

the last two rows mapped %: 0.826 and 0.174.  

 

How to interpret these results? What these two values mean here? Thank you!

ADD COMMENTlink modified 6.2 years ago by Devon Ryan97k • written 6.2 years ago by niu2rseq70

You'll need to paste the command you issued. There are multiple ways to run miRdeep2 and I suspect that the 34.82% and 60.72% metrics are from different steps in the pipeline.

ADD REPLYlink written 6.2 years ago by Devon Ryan97k

thanks Devon!

Here is the command I used:

mapper.pl *S1_L001_R1_001.fastq -e -h -i -j -k TGGAATTCTCGGGTGCCAAGG -l 18 -m -p ensembl_genome.fa -s S1_reads_fastq.fa -t S1_ensembl.arf -v

ADD REPLYlink written 6.2 years ago by niu2rseq70
3
gravatar for Devon Ryan
6.2 years ago by
Devon Ryan97k
Freiburg, Germany
Devon Ryan97k wrote:

Since you're using the -m ("collapse reads") option, the output from bowtie (e.g., "reads that failed to align: 39152 (60.72%)") will be metrics for the collapsed reads. The final mapping statistics are of the uncollapsed reads.

BTW the final mapping statistics aren't actually percentages, though they will be if you multiply them by 100. That's something that should really be fixed in mirdeep2.

ADD COMMENTlink written 6.2 years ago by Devon Ryan97k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1493 users visited in the last hour