Convert Fas/Qual Into Fastq?
5
1
Entering edit mode
9.3 years ago
Ahdf-Lell-Kocks ★ 1.6k

How can I convert a fasta file with it's associated qual file into a fastq file?

Example:

==> contigs.fas <==
>Contig1 2221 reads, 573 bases
CAAGGAAGTGCTCCAGRAGCTGCAGGTGGGAATTCTCTTGCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCT
TTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAA
AGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACT
ACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGT
TTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTC
TAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGTAGATAAAATCACCGGCTTGCCTGTTTTTGCC
ACTTTTTCTAATAAGGGATAAAAGGTTAAATCACCAGAGGCAATTTTAAATCAGGCACATAAAAAAAAAAAGAAAAAAA
AAARCTCCTAGTAGACGATC
>Contig2 1005 reads, 266 bases
[...]

==> contigs.qual <==
>Contig1 2221 reads, 573 bases
49 48 42 50 42 47 37 46 45 47 43 41 39 33 43 38 33 52 53 65 46 63 55 46 59 48 
20 31 30 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
[...]
fastq fasta quality conversion • 9.0k views
ADD COMMENT
4
Entering edit mode
9.3 years ago

This was asked before and I have posted a script. I will dig it out for you...

Try the perl-script here:

How to convert 454 data to SAM format?

ADD COMMENT
4
Entering edit mode
9.3 years ago
Daniel ★ 3.8k

There are a range of scripts provided by the Bio-Linux team at their code corner including one to Convert FASTQ to .fasta and .qual files and vice-versa

http://nebc.nerc.ac.uk/tools/code-corner/scripts/sequence-formatting-and-other-text-manipulation

Check it out.

ADD COMMENT
2
Entering edit mode
9.3 years ago
Eric Fournier ★ 1.4k

I had to do this very thing yesterday, and used a script I found off SEQAnswers: http://seqanswers.com/forums/showthread.php?t=2775

ADD COMMENT
0
Entering edit mode
9.3 years ago
ALchEmiXt ★ 1.9k

Try using the galaxy platform which can help you a lot usegalaxy.org for some free public server(s).

ADD COMMENT
0
Entering edit mode
4 months ago
anicet.ebou ▴ 170

fastaq is a comand-line utility available in Linux (ubuntu). Hope this can help:

sudo apt-get install fastaq
fastaq fasta_to_fastq in.fna in.qual out.fastq
ADD COMMENT

Login before adding your answer.

Traffic: 1645 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6