Question: Convert Fas/Qual Into Fastq?
1
gravatar for Ahdf-Lell-Kocks
8.1 years ago by
Ahdf-Lell-Kocks1.6k
Ahdf-Lell-Kocks1.6k wrote:

How can I convert a fasta file with it's associated qual file into a fastq file?

Example:

==> contigs.fas <==
>Contig1 2221 reads, 573 bases
CAAGGAAGTGCTCCAGRAGCTGCAGGTGGGAATTCTCTTGCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCT
TTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAA
AGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACT
ACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGT
TTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTC
TAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGTAGATAAAATCACCGGCTTGCCTGTTTTTGCC
ACTTTTTCTAATAAGGGATAAAAGGTTAAATCACCAGAGGCAATTTTAAATCAGGCACATAAAAAAAAAAAGAAAAAAA
AAARCTCCTAGTAGACGATC
>Contig2 1005 reads, 266 bases
[...]

==> contigs.qual <==
>Contig1 2221 reads, 573 bases
49 48 42 50 42 47 37 46 45 47 43 41 39 33 43 38 33 52 53 65 46 63 55 46 59 48 
20 31 30 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 
[...]
fasta fastq quality conversion • 8.1k views
ADD COMMENTlink modified 8.1 years ago by Eric Fournier1.4k • written 8.1 years ago by Ahdf-Lell-Kocks1.6k
4
gravatar for Michael Dondrup
8.1 years ago by
Bergen, Norway
Michael Dondrup47k wrote:

This was asked before and I have posted a script. I will dig it out for you...

Try the perl-script here:

How to convert 454 data to SAM format?

ADD COMMENTlink modified 6.8 years ago by Istvan Albert ♦♦ 82k • written 8.1 years ago by Michael Dondrup47k
4
gravatar for Daniel
8.1 years ago by
Daniel3.8k
Cardiff University
Daniel3.8k wrote:

There are a range of scripts provided by the Bio-Linux team at their code corner including one to Convert FASTQ to .fasta and .qual files and vice-versa

http://nebc.nerc.ac.uk/tools/code-corner/scripts/sequence-formatting-and-other-text-manipulation

Check it out.

ADD COMMENTlink modified 6.8 years ago by Istvan Albert ♦♦ 82k • written 8.1 years ago by Daniel3.8k
2
gravatar for Eric Fournier
8.1 years ago by
Eric Fournier1.4k
Quebec, Canada
Eric Fournier1.4k wrote:

I had to do this very thing yesterday, and used a script I found off SEQAnswers: http://seqanswers.com/forums/showthread.php?t=2775

ADD COMMENTlink written 8.1 years ago by Eric Fournier1.4k
0
gravatar for ALchEmiXt
8.1 years ago by
ALchEmiXt1.9k
The Netherlands
ALchEmiXt1.9k wrote:

Try using the galaxy platform which can help you a lot usegalaxy.org for some free public server(s).

ADD COMMENTlink written 8.1 years ago by ALchEmiXt1.9k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1453 users visited in the last hour