Observed and expected fastq header count different when merging two fastq files
0
0
Entering edit mode
5.6 years ago
nalandaatmi ▴ 90

Hi All,

Recently I concatenated two fastq files from one library belonging to the same sample but loaded in different lanes, using the following command.

cat Sample01_L001_R1.all.fastq.gz Sample01_L006_R1.all.fastq.gz > Sample01_L001-6_R1.all.fastq.gz

Sample fastq file content:

@HISEQ:137:C8W59ACXX:1:1101:1183:2157 1:N:0:TATGGC
GTATCATTAAAACTTTTACGATCAATCTTTTTAATAAGAACTAAATTATAATAAAATCCATATGTTGCCACAGGCGGGAAAAAAAAAAGGAAGGAAAAAAA
+
BBBFFFFFFFFFFBIIIIIIFFIIIIIIIFFIFFF<FBBFFFIIIIIIIIFIIIFFIBFFFIIB<BF<FFFIBFFBBB'7BBB<7<BF7<'077'07BB7<

​To validate that all the lines have been copied to the output fastq file "Sample01_L001-6_R1.all.fastq.gz". I counted the number of lines in each fastq file using following command.

$ zcat Sample01_L001_R1.all.fastq.gz | grep '@HISEQ:137' | wc -l  

37,955,286

$ zcat Sample01_L006_R1.all.fastq.gz | grep '@HISEQ:137' | wc -l 

18,385,272

$ zcat Sample01_L001-6_R1.all.fastq.gz | grep '@HISEQ:137' | wc -l  

55,587,340

Expected count should be 56,340,558.

Why the number of fastq header count is different from the expected?

fastq RNA-Seq next-gen • 1.2k views
ADD COMMENT
1
Entering edit mode

hard to say - do it again, I agree that the counts should be the same, it is possible that the file has been corrupted in some manner

ADD REPLY
0
Entering edit mode

Thanks Istvan Albert. I will try it again.

ADD REPLY
0
Entering edit mode

Have you tried counting all lines and dividing by 4 to see what number you get?

To be safe you can also try this instead:

$ zcat seq1.fq.gz seq2.fq.gz | gzip -c > all.fq.gz

ADD REPLY
0
Entering edit mode

what are those numbers without the grep (all lines) ?

ADD REPLY
0
Entering edit mode

I know this isn't answering your question directly, but you can just supply your fastq files to the aligner, most aligners can merge them for you. I know that STAR does that for sure.

ADD REPLY

Login before adding your answer.

Traffic: 2234 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6