Question: Finding hg19 coordinates for primers to make BED file
0
gravatar for adnan.haider.ra
3.7 years ago by
Pakistan
adnan.haider.ra10 wrote:

Hello everyone! 

As title suggests, I have designed primers for a gene (BRCA1) with help of ExonPrimer using hg19 as template. Problem is that in order to make manifest file in Illumina Experiment Manager (IEM) for PCR Amplicon Workflow, I need to have hg19 start and end co-ordinates of my amplicons but I have not been suplied this bit of information. So, is there any way of getting co-ordinates with help of forward and reverse primer sequences?

For Example, I have been supplied this bit of information for exon1 of BRCA1 gene,

Assembly Feb. 2009 (GRCh.37/hg19)      
UCSC ID uc002icq.3        
RefSeq   (Accession#)  NM_007294        
Description Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA
Link: http://genome.ucsc.edu/cgi-bin/hgGene?hgg_gene=uc002icq.3&hgg_prot=P38398&hgg_chrom=chr17&hgg_start=41196311&hgg_end=41277500&hgg_type=knownGene&db=hg19&hgsid=465092029_PO9baMwFwF3f1U3frs2NPFn2sAJL
           
Transcript (Including UTRs)  Position: chr17:41,196,312-41,277,500 Size: 81,189 Total Exon Count: 23
           
Coding Region Position: chr17:41,197,695-41,276,113 Size: 78,419 Coding Exon Count: 22 
Codon Exon Size
Product Size
Start (left)
End (Right)
Forward Primer
Reverse Primer
2
80 bp
832
2223
3054
GGACGTTGTCATTAGTTCTTTGG
caacatctgcctcctggttc

 

             
hg19 coordinates primers • 2.0k views
ADD COMMENTlink modified 17 months ago by bioinfo8940 • written 3.7 years ago by adnan.haider.ra10

How many primers do you have? If you only have a few then you could just blast them online.

ADD REPLYlink written 3.7 years ago by Devon Ryan91k

Hi,

I have a similar query!! I have forward and reverse primers for 400 amplicons and I want to extract the start and end coordinates of the primers to soft clip them. Is there a way to do this?

I checked Insilco PCR. It does not provide the coordinates for primers!

Thanks!

ADD REPLYlink written 17 months ago by bioinfo8940

Please use ADD COMMENT or ADD REPLY to answer to previous reactions, as such this thread remains logically structured and easy to follow. I have now moved your reaction but as you can see it's not optimal. Adding an answer should only be used for providing a solution to the question asked.

This might be more appropriate as a separate question.

ADD REPLYlink modified 17 months ago • written 17 months ago by WouterDeCoster40k
0
gravatar for igor
3.7 years ago by
igor8.3k
United States
igor8.3k wrote:

The easiest way (if you only have a few sequences) to convert from primers to coordinates is to use UCSC In-Silico PCR: http://genome.ucsc.edu/cgi-bin/hgPcr

 

ADD COMMENTlink written 3.7 years ago by igor8.3k

Thanks a lot @igor :) 

ADD REPLYlink written 3.7 years ago by adnan.haider.ra10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1668 users visited in the last hour