Question: Where to get list of all Illumina adapters
0
gravatar for umn_bist
3.2 years ago by
umn_bist320
umn_bist320 wrote:

Previously I have been using FastQC to identify overrepresented sequences (adapters) to feed cutadapt tool for trimming.

 

Right now I have about 50 bam files (sequenced by Illumina) that need quality control including removing adapter seq, but I cannot go through FastQC individually to identify each "unique" adapters.

That said, I am wondering if it's possible to preload a long list of all known Illumina adapters into cutadapt? If so is there a simple text file that holds these adapters? If this is not the best method I am open to alternative solutions. Thank you guys for your help.

 

 

ADD COMMENTlink modified 3.2 years ago by Juke-342.1k • written 3.2 years ago by umn_bist320
2
gravatar for trausch
3.2 years ago by
trausch1.2k
Germany
trausch1.2k wrote:

illumina adapter sequences are available here:

https://support.illumina.com/downloads/illumina-customer-sequence-letter.html

 

ADD COMMENTlink written 3.2 years ago by trausch1.2k

Thank you for your reply. Is there a place to download a fasta file of all illumine adapters in RNA seq samples? I had previously been to that link but I am curious if a special format is necessary to build a custom fasta. If not, which libraries are considered relevant for RNA samples? Thanks again.

ADD REPLYlink written 3.2 years ago by umn_bist320
2

PDF seems like the dumbest format ever for a list of primers. Has anyone come across this table in Excel, tsv or some other format that makes sense?

ADD REPLYlink written 2.5 years ago by Maximilian Haeussler1.3k
1
gravatar for Juke-34
3.2 years ago by
Juke-342.1k
Sweden
Juke-342.1k wrote:

You have to use the -a parameter in cutadapt: http://cutadapt.readthedocs.org/en/stable/guide.html#removing-adapters

-a AdaptorList.fasta

ADD COMMENTlink written 3.2 years ago by Juke-342.1k

Thank you for your reply. Does the fasta file for adapter list require a special format? Is it as simple as creating a txt file with a list of all adapters and changing the file extension to fasta? I can only guess cutadapt or any clippers won't know how to differentiate a 3' adapter from a 5' adapter. Which Illumina libraries are considered relevant for RNA samples? The samples were retrieved from CGHub (unaligned) so I don't know which Illumina version these samples used. From the link posted above I found TruSeq, TruSeq short, and Oligonucleotide Sequences for the v1 and v1.5 Small RNA Kits. Thanks again.

ADD REPLYlink written 3.2 years ago by umn_bist320
1

" Does the fasta file for adapter list require a special format? " strange question ... it requires FASTA format.

>TruSeq Adapter, Index 11

GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG 

If you don't know which adaptors have been used, you put all in the fasta file. It should work fine. For differentiation between 3' and 5'adapters, I don't know...

ADD REPLYlink written 3.2 years ago by Juke-342.1k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 710 users visited in the last hour