Question: I loaded a DNA-seq BAM file in IGV but I can't see anything
0
gravatar for grosfish69
3.1 years ago by
grosfish690
grosfish690 wrote:

I loaded a BAM file in IGV but I can't see anything. My reference genome is Human hg19. I don't know which chromosome to choose and which region to zoom in.

I tried to read the BAM file header with samtools but I don't understand what information to extract:

I wrote that in the terminal

 samtools view -h [bamfile] | head -100

OUTPUT

 aln.bam | head -88
@HD VN:1.0  SO:unsorted

@SQ SN:1    LN:249250621

@SQ SN:2    LN:243199373

@SQ SN:3    LN:198022430

@SQ SN:4    LN:191154276

@SQ SN:5    LN:180915260

@SQ SN:6    LN:171115067

@SQ SN:7    LN:159138663

@SQ SN:8    LN:146364022

@SQ SN:9    LN:141213431

@SQ SN:10   LN:135534747

@SQ SN:11   LN:135006516

@SQ SN:12   LN:133851895

@SQ SN:13   LN:115169878

@SQ SN:14   LN:107349540

@SQ SN:15   LN:102531392

@SQ SN:16   LN:90354753

@SQ SN:17   LN:81195210

@SQ SN:18   LN:78077248

@SQ SN:19   LN:59128983

@SQ SN:20   LN:63025520

@SQ SN:21   LN:48129895

@SQ SN:22   LN:51304566

@SQ SN:X    LN:155270560

@SQ SN:Y    LN:59373566

@SQ SN:MT   LN:16569

@SQ SN:GL000207.1   LN:4262

@SQ SN:GL000226.1   LN:15008

@SQ SN:GL000229.1   LN:19913

@SQ SN:GL000231.1   LN:27386

@SQ SN:GL000210.1   LN:27682

@SQ SN:GL000239.1   LN:33824

@SQ SN:GL000235.1   LN:34474

@SQ SN:GL000201.1   LN:36148

@SQ SN:GL000247.1   LN:36422

@SQ SN:GL000245.1   LN:36651

@SQ SN:GL000197.1   LN:37175

@SQ SN:GL000203.1   LN:37498

@SQ SN:GL000246.1   LN:38154

@SQ SN:GL000249.1   LN:38502

@SQ SN:GL000196.1   LN:38914

@SQ SN:GL000248.1   LN:39786

@SQ SN:GL000244.1   LN:39929

@SQ SN:GL000238.1   LN:39939

@SQ SN:GL000202.1   LN:40103

@SQ SN:GL000234.1   LN:40531

@SQ SN:GL000232.1   LN:40652

@SQ SN:GL000206.1   LN:41001

@SQ SN:GL000240.1   LN:41933

@SQ SN:GL000236.1   LN:41934

@SQ SN:GL000241.1   LN:42152

@SQ SN:GL000243.1   LN:43341

@SQ SN:GL000242.1   LN:43523

@SQ SN:GL000230.1   LN:43691

@SQ SN:GL000237.1   LN:45867

@SQ SN:GL000233.1   LN:45941

@SQ SN:GL000204.1   LN:81310

@SQ SN:GL000198.1   LN:90085

@SQ SN:GL000208.1   LN:92689

@SQ SN:GL000191.1   LN:106433

@SQ SN:GL000227.1   LN:128374

@SQ SN:GL000228.1   LN:129120

@SQ SN:GL000214.1   LN:137718

@SQ SN:GL000221.1   LN:155397

@SQ SN:GL000209.1   LN:159169

@SQ SN:GL000218.1   LN:161147

@SQ SN:GL000220.1   LN:161802

@SQ SN:GL000213.1   LN:164239

@SQ SN:GL000211.1   LN:166566

@SQ SN:GL000199.1   LN:169874

@SQ SN:GL000217.1   LN:172149

@SQ SN:GL000216.1   LN:172294

@SQ SN:GL000215.1   LN:172545

@SQ SN:GL000205.1   LN:174588

@SQ SN:GL000219.1   LN:179198

@SQ SN:GL000224.1   LN:179693

@SQ SN:GL000223.1   LN:180455

@SQ SN:GL000195.1   LN:182896

@SQ SN:GL000212.1   LN:186858

@SQ SN:GL000222.1   LN:186861

@SQ SN:GL000200.1   LN:187035

@SQ SN:GL000193.1   LN:189789

@SQ SN:GL000194.1   LN:191469

@SQ SN:GL000225.1   LN:211173

@SQ SN:GL000192.1   LN:547496

@RG ID:Bordet_EGFR_S1   SM:S1   PL:Illumina

@PG ID:bowtie2  PN:bowtie2  VN:2.0.2
M01636:3:000000000-A442D:1:1102:18789:14479 99  1   326181  1   11S140M =   326217  189 CACACTGACGTGCCTCTCCAGACCCACTTGCACCCTCCGGGCGTTCTCTCCGGGCCCAGCTCTTCTTCCTGGTTGGGTCTCCAGGCCCGATTCCTGCCTCTCAACAACCTCTTTGGACTCAGTGCCTACCCATCTCCTGGCGGCCTTGGTC BBBBBFFFFBBAEGGGGGGGGGGHHHCFHHHGHHGHGGGGGGGGCFFHHHHGGGGEGDHHGFGG3FGHHHFEGHEGGGGHHFHHGEFFGGGGH4FGEGFFHGHFGHFHGHHHFHGHHGHHHFBHHFHBHHGHHHHHFFFHG-CGGDGFHHB AS:i:280    XS:i:280    XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:140    YS:i:275    YT:Z:CP RG:Z:Bordet_EGFR_S1

How to find the correct chromosome and the region of interest?

Thanks

sequence next-gen alignment gene • 1.2k views
ADD COMMENTlink modified 3.1 years ago by h.mon24k • written 3.1 years ago by grosfish690
1
gravatar for mastal511
3.1 years ago by
mastal5112.0k
mastal5112.0k wrote:

I think you need to sort and index the bam file using samtools before you can see anything in IGV.

ADD COMMENTlink written 3.1 years ago by mastal5112.0k

@mastal511 I have the [bam.bai] file in the same folder as the bam file. Is that what I have to do? How do I sort the bam file?

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by grosfish690

Did you sort the BAM file before indexing it (which creates the .bai file)?

ADD REPLYlink written 3.1 years ago by genomax64k

Actually my instructor sent me 4 files:

- aln1.fastq
- aln2.fastq
- aln.bam
- aln.bam.bai

That's why I was thinking that it was already sorted. As genomax2 said it's maybe because my reference genome is not hg19. How can I set it as reference in samtools?

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by grosfish690

Your BAM file header is showing that it is unsorted. You should sort and then index again.

@HD VN:1.0  SO:unsorted
ADD REPLYlink written 3.1 years ago by genomax64k
samtools sort aln.bam aln.sort
samtools index aln.sort.bam
ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by Nicolas Rosewick7.4k
0
gravatar for genomax
3.1 years ago by
genomax64k
United States
genomax64k wrote:

In addition to @mastal511's suggestion it looks like you have "ensembl" version of the genome/annotation where as the default "genome" in IGV is UCSC (which uses chr1 etc). So you may need to load the ensembl version of hg19 in IGV as a "new genome".

ADD COMMENTlink written 3.1 years ago by genomax64k

@genomax2 I downloaded the hg19 reference genome. How do I set it as new reference?

ADD REPLYlink written 3.1 years ago by grosfish690

Is your data aligned to ensembl's hg19?

ADD REPLYlink written 3.1 years ago by genomax64k

The instruction says:

raw file is aligned to hg19 human genome.
ADD REPLYlink written 3.1 years ago by grosfish690

Sources use different nomenclature for same genome build (e.g. UCSC uses chr1 where as ensembl has just 1).

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by genomax64k
1

actually IGV can handle the chr1 vs 1 matching nowadays (one small step for man, one giant leap for mankind)

ADD REPLYlink written 3.1 years ago by Istvan Albert ♦♦ 79k
0
gravatar for h.mon
3.1 years ago by
h.mon24k
Brazil
h.mon24k wrote:

In addition to mastal511 and genomax2 suggestions, have you zoomed enough?

ADD COMMENTlink written 3.1 years ago by h.mon24k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 966 users visited in the last hour