Fast visualisation of BLAST search hits' annotations
1
2
Entering edit mode
5.3 years ago

Hello, I'm new in bioinformatics. I have (I think) a very silly issue:

Doing a web based NCBI BLAST search against nr/nt database; when you get as a hit a fragment from a contig or a complete genome assembly, regardless that fragment is well annotated inside the entire sequence (as a well known gene or whatever), you only see, for example, "Pityopsis falcata, partial genome" as the hit title.

That bothers me. I have to click in the sequence ID and search the fragment position to find out how was annotated that stupid sequence. I feel like an idiot making so many clicks.

Like I said, my "problem" is silly, but there has to be a solution.

Thanks in advance!

blast annotation visualisation • 1.7k views
ADD COMMENT
0
Entering edit mode

Try blasting against refseq database.

ADD REPLY
1
Entering edit mode
5.2 years ago

I've written something like this for an old post: Aligning Two Proteins With Their Domains/Annotations see

https://github.com/lindenb/jvarkit/wiki/Biostar3654

$ cat ~/jeter.blastn.xml 

http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
<BlastOutput>
(...)
<Hit>
  <Hit_num>1</Hit_num>
  <Hit_id>gi|14971104|gb|AF338247.1|</Hit_id>
  <Hit_def>Human rotavirus A strain M clone M1 NSP3 genes, complete cds</Hit_def>
  <Hit_accession>AF338247</Hit_accession>
  <Hit_len>2032</Hit_len>
  <Hit_hsps>
    <Hsp>
      <Hsp_num>1</Hsp_num>
```

```
$ java -jar dist/biostar3654.jar ~/jeter.blastn.xml 2> /dev/null  | cut -c-${COLUMNS} 

QUERY: No definition line
       ID:Query_186611 Len:980
>Human rotavirus A strain M clone M1 NSP3 genes, complete cds
 AF338247
 id:gi|14971104|gb|AF338247.1| len:2032

   e-value:0 gap:0 bitScore:1764.98

QUERY 000000001 GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGC 000000050
                ||||||||||||||||||||||||||||||||||||||||||||||||||
HIT   000000001 GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGC 000000050
                ################################################## source organi
                ##################################                 5'UTR
                                                  ################ CDS codon_sta

QUERY 000000051 AGATGGTAAGCTCTATTATTAATACTTCTTTTGAAGCTGCAGTCGTTGCT 000000100
                ||||||||||||||||||||||||||||||||||||||||||||||||||
HIT   000000051 AGATGGTAAGCTCTATTATTAATACTTCTTTTGAAGCTGCAGTCGTTGCT 000000100
                ################################################## source organi
                ################################################## CDS codon_sta
(...)
ADD COMMENT

Login before adding your answer.

Traffic: 1951 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6