Question: Fast visualisation of BLAST search hits' annotations
0
gravatar for Andrés Ribone
10 months ago by
Andrés Ribone0 wrote:

Hello, I'm new in bioinformatics. I have (I think) a very silly issue:

Doing a web based NCBI BLAST search against nr/nt database; when you get as a hit a fragment from a contig or a complete genome assembly, regardless that fragment is well annotated inside the entire sequence (as a well known gene or whatever), you only see, for example, "Pityopsis falcata, partial genome" as the hit title.

That bothers me. I have to click in the sequence ID and search the fragment position to find out how was annotated that stupid sequence. I feel like an idiot making so many clicks.

Like I said, my "problem" is silly, but there has to be a solution.

Thanks in advance!

ADD COMMENTlink modified 9 months ago by Pierre Lindenbaum103k • written 10 months ago by Andrés Ribone0

Try blasting against refseq database.

ADD REPLYlink written 10 months ago by h.mon10k
1
gravatar for Pierre Lindenbaum
9 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum103k wrote:

I've written something like this for an old post: Aligning Two Proteins With Their Domains/Annotations see

https://github.com/lindenb/jvarkit/wiki/Biostar3654

$ cat ~/jeter.blastn.xml 

http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
<BlastOutput>
(...)
<Hit>
  <Hit_num>1</Hit_num>
  <Hit_id>gi|14971104|gb|AF338247.1|</Hit_id>
  <Hit_def>Human rotavirus A strain M clone M1 NSP3 genes, complete cds</Hit_def>
  <Hit_accession>AF338247</Hit_accession>
  <Hit_len>2032</Hit_len>
  <Hit_hsps>
    <Hsp>
      <Hsp_num>1</Hsp_num>
```

```
$ java -jar dist/biostar3654.jar ~/jeter.blastn.xml 2> /dev/null  | cut -c-${COLUMNS} 

QUERY: No definition line
       ID:Query_186611 Len:980
>Human rotavirus A strain M clone M1 NSP3 genes, complete cds
 AF338247
 id:gi|14971104|gb|AF338247.1| len:2032

   e-value:0 gap:0 bitScore:1764.98

QUERY 000000001 GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGC 000000050
                ||||||||||||||||||||||||||||||||||||||||||||||||||
HIT   000000001 GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGC 000000050
                ################################################## source organi
                ##################################                 5'UTR
                                                  ################ CDS codon_sta

QUERY 000000051 AGATGGTAAGCTCTATTATTAATACTTCTTTTGAAGCTGCAGTCGTTGCT 000000100
                ||||||||||||||||||||||||||||||||||||||||||||||||||
HIT   000000051 AGATGGTAAGCTCTATTATTAATACTTCTTTTGAAGCTGCAGTCGTTGCT 000000100
                ################################################## source organi
                ################################################## CDS codon_sta
(...)
ADD COMMENTlink modified 9 months ago • written 9 months ago by Pierre Lindenbaum103k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1580 users visited in the last hour