Removing running backlash from my fasta sequences
1
0
Entering edit mode
4.1 years ago
eennadi • 0

Please how do i remove a running backslash that divides my sequences into half?

\TTTATAAATTGATGGGGTGGATGAATTCAGACTCATTATTATGATATACTTTATTTTAT T\TTATTTTTCTTCTTTTTACATGTACATTGAGAAAAAATAAAGTATACAAATTCATCTC AA\AGCATTATATGACTTTAACATATATGACTTTTATGATATTTAAATGTTATTAAAAAT ATA\AAAATATACTACTCGATCATAAAAATATTGATAATATTTTTATAATAAAATATTAA TAAA\AGTAATATACATAGTAATGTTAATTTTATATATATCCGCTCAAAAATGATCTCAA TTTGA\TGATTGCTTCGGTTGGTTTCTCTCTTTTCTTTTCTTTTTATCTCTTTTCTTCCG CCTCAA\ATCTGCCCTAAAATGGGGCGGCAGTTTATATTTTTGGTATGAGTATTTACTAG TTGGATA\CGTGAAATAGTGTGATGAGTAAATGTGCATTGGAAATAGGGAAGGTTGGACT GGACAGGT\CTTAATAGTTATTATTACAATTCGCCGCCGGCATGGTTTGGCACGTAACTA ACCTTCATT\GATTTTTTTTTCTGTACTTTTTATAAATATATTTTAAAGAAAATGTTTTT TCATTTATCA\TTTTATAGTTTTAATATAGCACTAATTATTATTTTTCAAGGTTTTGTTA AGGTATTGGTT\AAGAATGAATAATATACATTTTTATTGAAATTTCATTTTGTAGAAATT TAAAACTGTAAA\AAGAAGATTTTAGAAAGGATTATTTGTCTTTTTCTATAGTTTGATTT CAGTTTCTTGTTG\TTTACGTTGAAATAAAAATAATTATAAAATTTTAGTAGAATAATTT TTTTTAATTCATGT\TCCTATACAAGTATCCTGTGTCTACGTCCTAGTTACAAAGATGTC CGCTTTTAGAGTTAA\AAAGCATGTAATATAGTAAGTGTGAGTGATTTCTTCCCTTGTGT TAGTGGAGGTAGTCAG\TTACTAATCTGGTACTAAAGTTCGAATAATAATTTTATCAGTC AAAAGTTGAGCCAGTGT\AATTTTCTTCGTAAAATAACTTAGTTTTAATTTTTTTTCCCA ACTTGAAAAAAAATGAGC\TATTGCATTTTATTCATCATGTATAATATAATACAATAAAT AAAAAGAGACGAATTGGGG\AAATTGATTACTCAAATACAATATCTTCAATTAACTTTTA TCTATACATACTCAATCATG\ATCCGATACTATTACAGACAAAAATACTTTTAGATTTAG GGTAAGACTGATCCTCAAACT\AACAAGCTTATTATAAAGTCGTTAAAACCTAGTTCTTA ATTAGTAGTACTAAATTATCGA\AAACTGATCACTCTAAAATCTGACGGATTACTTTTTA ATTAATGAGTTCATAAAAGCCCC\TAAAATTTGATTAATTTTCGAATTAATAAGTTCATA AAGCATCTAAAACTTAGTTTATAG\TGTTAAATATTAAGTTAATGAGCACCAAGCATTCT AAAATCTATCCCATCACTGTCCGAC\CGATGTGAAGCCAAGTCCAACCAAGCAATTCCAA AACGTGGTGAGAAGTTAGAATAGGTA\TATTTTAGTAATCAACAAAAGAATCTATTTCAT GTTTGTTACAAACAGGGACGGAGGTAT\ATGTATGGTGGGGGGCTTGTCTCTCTAAGTTT TTTTAATATATCCGATATTTTAAGGTTA\AGAAATTTTTTTTTATTTAGAATTTGATTGT AAAAATAATAATATTTAAGTATTATTTTT\AATAAAATAATAAAAAAATAGTCCTATTAT AAAAATAATAACATTATTTTTTATTTTTAA\ATAAATGTTTTATTTTATTTTATAGTATT TGTTTTAGAAATATTATATTTTCATCTTCTT\AGACAAAATATATTTAAGTATTATTTTT ATTTTTTTTAGAATTTATTATTACTATTTTTA\AAATTATAAATAATTGCATTTAAATTA AATAATACTTTTAGTCTTTCATTTACCTTGATT\TAATAATTAAATTTTATTTATTAACT TTTGTTAATGAGACAAGTTTATAAACAAGAAAAT\GACAACTTAAATTTTGAAGGATCAA CATATATTTCTTCTTTCTATGACTTTTTTTTTTTG\TGTATATATATTGTTTTATTTTAC GTCTCTTATATTTTTTATTGTTATTATTTTTAGACT\CTAATATGCAGTGAGAAAGTTAA CAAATAAGTACAAAAAAAATATGATATTTATAATATT\GATTTTTTAATATTTAATTTAT TTTTGTTATTTTTTATTTAGATTCTTGAATCACTTTAA\AAAATATTTAATTACAAGTAT TTATATATTTAAGTAAAATTGATATTTATATATTTATTA\AATAAATTTAATTTTTATAA TTCAACCCTAATATCTATCCCTGCATCCGTCCC

Assembly • 845 views
ADD COMMENT
0
Entering edit mode

a running backslash that divides my sequences into half

What exactly does that mean?

ADD REPLY
0
Entering edit mode

input:

$ cat test.txt 
>test1
\ATGC
>test2
A\T\\GC\
>test3
\AT\\\GC

output:

 $ seqkit replace -sp  '\\' -r ""   test.txt
>test1
ATGC
>test2
ATGC
>test3
ATGC

$ sed 's_\\__g' test.txt 
>test1
ATGC
>test2
ATGC
>test3
ATGC

get seqkit from here

ADD REPLY
0
Entering edit mode

What's the advantage of seqkit over sed here?

ADD REPLY
0
Entering edit mode
4.1 years ago
Ram 35k
sed 's#\\##g' fasta_file.fa >fasta_cleaned.fa.
ADD COMMENT

Login before adding your answer.

Traffic: 2089 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6