Question: How to extract reads with a known variant form a bam file
gravatar for 1097049297
2.9 years ago by
10970492970 wrote:

I want to extract reads with a known variant form a bam file, I have tried like below:

$samtools -q 30 view  <in bam> <position> | grep -i <pattern sequence(like AATTCG)> # reference pattern is AA[C]TCG

However maybe it would be some problem like if a SNP in the pattern or recurrent pattern in reads

So if any one know some better way to do the job, maybe mpileup function could help but I don not know how to do it.


snp bam • 2.3k views
ADD COMMENTlink modified 2.9 years ago by dariober11k • written 2.9 years ago by 10970492970

see also: how to extract allele specific reads from bamfiles?

ADD REPLYlink written 2.9 years ago by Pierre Lindenbaum131k
gravatar for Pierre Lindenbaum
2.9 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum131k wrote:


with the following script (searching for a base 'T' on 'rotavirus' at 1044.

final String contig= "rotavirus";
final int mutpos = 1044;
final char mutbase='T';
if(record.getReadUnmappedFlag()) return false;
if(!record.getContig().equals(contig)) return false;
if(record.getEnd() < mutpos) return false;
if(record.getStart() > mutpos) return false;
int readpos = record.getReadPositionAtReferencePosition(mutpos);
if(readpos<1) return false;
final byte[]    bases= record.getReadBases();
if(bases[readpos]==mutbase) return true;
return false;


 java -jar dist/samjdk.jar -f script.js input.bam


@HD VN:1.5  GO:none SO:coordinate
@SQ SN:rotavirus    LN:1074
@RG ID:S2   SM:S2
@PG ID:bwa  PN:bwa  VN:0.7.12-r1044 CL:../bwa/bwa mem -R @RG\tID:S2\tSM:S2 ref.fa S2_01_R1.fq.gz S2_01_R2.fq.gz
@PG ID:bwa.1    PN:bwa  VN:0.7.12-r1044 CL:../bwa/bwa mem -R @RG\tID:S2\tSM:S2 ref.fa S2_02_R1.fq.gz S2_02_R2.fq.gz
@PG ID:bwa.2    PN:bwa  VN:0.7.12-r1044 CL:../bwa/bwa mem -R @RG\tID:S2\tSM:S2 ref.fa S2_03_R1.fq.gz S2_03_R2.fq.gz
rotavirus_598_1046_7:0:0_4:0:0_7    83  rotavirus   977 60  70M =   598 -449    TATAAATATTTACCATCTACACATGACCCGCTATGAGCACAATAGTTAAAAGCTAACACTGTCAAAATCC  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++  MD:Z:2A7A18T37A2    RG:Z:S2 NM:i:4  AS:i:54 XS:i:0
rotavirus_486_1047_6:0:0_1:0:0_1cc  83  rotavirus   978 60  70M =   486 -562    AAAAATATTAACCATCTACACATGACCCTCTATGAGCACAATAGTTAAAAGCTAACACTGTCAAAATCCT  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++  MD:Z:66A3   RG:Z:S2 NM:i:1  AS:i:66 XS:i:0
rotavirus_492_1049_13:0:0_3:0:0_309 147 rotavirus   984 60  4S66M   =   494 -556    TAAGATTAACCATCTACACATGACCCTCTATGAGCACAATAGTTAAAAGCTAACACTGTCAAAATCCTAA  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++  MD:Z:60A5   RG:Z:S2 NM:i:1  AS:i:61 XS:i:0
rotavirus_549_1057_2:0:0_7:0:0_27c  147 rotavirus   988 60  68M2S   =   549 -507    ACCATCTACACAGGACACTCTATGAGCACAATACTTTAAAGCTAACTCTGTCAAAATCCTAAATGGCTTT  ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++  MD:Z:12T3C16G2A9A9A11   RG:Z:S2 NM:i:6  AS:i:38 XS:i:0
ADD COMMENTlink modified 2.9 years ago • written 2.9 years ago by Pierre Lindenbaum131k

Hi Pierre,

Thank you for the script. It has helped me a lot to select reads that contain a substitution mutation in my cDNA sequencing data. However, I would like to do the same thing for selecting reads that have indel mutations (both 1 bp and multiple bp), and splice site mutations. The splice site mutations are located intronically, and thus not always present in my reads, so a selection for these would have to be based on splicing (such as exon skipping). Do you know a way to do this using your program?

Thank you!

ADD REPLYlink written 11 months ago by lena.duchateau10

Hello Pierre,

Your script is very useful in my research. And is there a way to dissect with multiple-base pattern in a specified region from BAM file? (Like extract alignment with chr19:100000-100003 as ATCG in reverse strand). Another question is I noticed that in the manual of samjdk there is a specification: --pair [20171110] PAIR-MODE .The signature of java function is public Object apply(final List<SAMRecord> records). This function must return true to accept the whole list, false to reject eveything, or another List<SAMRecord>.Input MUST be sorted on query name using picard SortSam (not samtools sort ). Does that mean when I using pairend BAM files as input, I should use picard to sort them first?

Thank you!

ADD REPLYlink written 20 months ago by Yijun Tian20

And is there a way to dissect with multiple-base pattern in a specified region from BAM file?

yes, test all the positions

Does that mean when I using pairend BAM files as input, I should use picard to sort them first?


ADD REPLYlink written 20 months ago by Pierre Lindenbaum131k

Hi Pierre,

I have tried SortSam my BAM file by queryname with :

java -jar ~/picard/build/libs/picard.jar SortSam I=22RV1-DHT_CTCF.bam O=22RV1-DHT_CTCF.psort.bam SORT_ORDER=queryname

And when add --pair to the script you provide in samjdk and run as :

 java -jar dist/samjdk.jar --pair -f hg38-rs12611084-A.js *.psort.bam > output.bam

The program warning:

[WARN][InMemoryCompiler]/ error: cannot find symbol if(record.getReadUnmappedFlag()) return false; ^symbol: variable record location: class SamJdkCustom1838586069 / error: cannot find symbol if(!record.getContig().equals(contig)) return false; ^ symbol: variable record location: class SamJdkCustom1838586069 / error: cannot find symbol if(record.getEnd() < mutpos) return false; ^ symbol: variable record location: class SamJdkCustom1838586069 / error: cannot find symbol if(record.getStart() > mutpos) return false; ^ symbol: variable record location: class SamJdkCustom1838586069 / error: cannot find symbol int readpos = record.getReadPositionAtReferencePosition(mutpos); ^ symbol: variable record location: class SamJdkCustom1838586069 / error: cannot find symbol final byte[] bases= record.getReadBases(); ^ symbol: variable record location: class SamJdkCustom1838586069 6 errors [SEVERE][InMemoryCompiler] failed for custom class SamJdkCustom1838586069 java.lang.RuntimeException: failed for custom class SamJdkCustom1838586069 at com.github.lindenb.jvarkit.lang.InMemoryCompiler.compileClass( at at com.github.lindenb.jvarkit.util.jcommander.Launcher.instanceMain( at com.github.lindenb.jvarkit.util.jcommander.Launcher.instanceMainWithExit( at [SEVERE][SamJdk]Cannot compile custom class SamJdkCustom1838586069 java.lang.RuntimeException: Cannot compile custom class SamJdkCustom1838586069 at com.github.lindenb.jvarkit.lang.InMemoryCompiler.compileClass( at at com.github.lindenb.jvarkit.util.jcommander.Launcher.instanceMain( at com.github.lindenb.jvarkit.util.jcommander.Launcher.instanceMainWithExit( at Caused by: java.lang.RuntimeException: failed for custom class SamJdkCustom1838586069 at com.github.lindenb.jvarkit.lang.InMemoryCompiler.compileClass( ... 4 more [INFO][Launcher]samjdk Exited with failure (-1)

I am sorry that I know very little about JAVA. Can you help me modify above script to let it run with pairend alignment?

Thank you!

ADD REPLYlink modified 20 months ago • written 20 months ago by Yijun Tian20

1) you're not using the latest version of the tool

2) in pair mode, the signature of the function that's need to be implemented contains a variable named records not record.

ADD REPLYlink written 20 months ago by Pierre Lindenbaum131k

Hi Pierre,

Based on your answer. I've tried my best to write below script. Do you think it's right to using it for extracting the alignment with SNPx?

final String contig= "chr17";
final int mutpos = 38256322;
final char mutbase='T';
return>R.getReadUnmappedFlag() == false && R.getContig()== contig && R.getEnd() >= mutpos&& R.getStart() <= mutpos && R.getReadBases()[R.getReadPositionAtReferencePosition(mutpos)]==mutbase);

Thank you!

I just realized that I can simply run the original script for single end data and extract the read pairs from the original BAM file by grep the reads name. That feels more comfortable. Thank you!


ADD REPLYlink modified 20 months ago • written 20 months ago by Yijun Tian20

Hi Pierre, Thank you very much for making this tool. Every time I need a not-so-standard tool there is one piece of software in jvarkit that does specifically what I want. This time I am interested in selecting reads supporting one allele, but I'd like to know how to select several positions specifying one base each time. I've tried this script.js, based on a simple modification of your script.js:

final String contig = "scaffold_3";
final int[] mutpos = {9379104, 9379106, 9379131, 9384562, 9414473, 9416683, 9416773, 9417122, 9417182, 9417260};
final char[] mutbase = {'T', 'G', 'A', 'T', 'T', 'A', 'A', 'G', 'C', 'C' };
int arrayLength = mutbase.length;
if(record.getReadUnmappedFlag()) return false;
if(!record.getContig().equals(contig)) return false;
for (int i = 0; i < arrayLength; i++){
  if(record.getEnd() < mutpos[i]) return false;
  if(record.getStart() > mutpos[i]) return false;
  int readpos = record.getReadPositionAtReferencePosition(mutpos[i]);
  if(readpos<1) return false;
  final byte[]    bases= record.getReadBases();
  if(bases[readpos]==mutbase[i]) return true;
  return false;
return false;

However, this ends up giving me less entries than using a single position.

Please note that this is my very first attempt to "code" anything in java. This does run, which I did not expect, but the results are not what I want. Is there a way to ask samjdk to return a read whenever a mutpos matches its corresponding mutbase?. I don't care if I got duplicated reads, I can sort and uniq them later (I'm testing some hundreds of SNPs, so the sort should be rather fast).

Of course a different option would be to run this once per SNP in a loop (that is, generate a script.js per SNP), but I'd rather run all at once.

Thank you again for writing jvarkit.

EDIT: Apparently the issue came from the return statement, that ends the for loop and finishes the script. I've modified the script and it works, I'm just leaving it here for anyone who comes in the future (maybe even myself!)

final String contig = "Your_Contig";
final int[] mutpos = {Pos1, Pos2, Pos3, PosN};
final char[] mutbase = {'BaseForPos1', 'BaseForPos2', 'BaseForPos3', 'BaseForPosN' };
int arrayLength = mutbase.length;
if(record.getReadUnmappedFlag())  return false;
if(!record.getContig().equals(contig)) return false;
ArrayList<htsjdk.samtools.SAMRecord> ret = new ArrayList<htsjdk.samtools.SAMRecord>();
for (int i=0; i < arrayLength; i++){
  if(record.getEnd() < mutpos[i]) continue;
  if(record.getStart() > mutpos[i]) continue;
  int readpos = record.getReadPositionAtReferencePosition(mutpos[i]);
  if(readpos<1) continue;
  final byte[]    bases= record.getReadBases();
  if(bases[readpos]==mutbase[i]) {
return ret;

I hope this is useful for someone else.

ADD REPLYlink modified 3 months ago • written 3 months ago by Carles Borreda0
gravatar for prasundutta87
2.9 years ago by
prasundutta87380 wrote:

The mpileup function is the best tool for this kind of job..try using the latest version though (1.6) as they have a new switch (qname) that allows you to get the read names of the piled up reads as well..the usage is pretty simple, many examples are present on the can Google it out.. otherwise, the main parameters to consider is base quality, mapping quality, depth at the particular position and also the region, which is one base in your case..all these options will be present in the mpileup helpfile itself.

ADD COMMENTlink modified 2.9 years ago • written 2.9 years ago by prasundutta87380
gravatar for chen
2.9 years ago by
chen2.1k wrote:

You can try MutScan, input the original FASTQ file and a VCF file that contains your variants.

ADD COMMENTlink modified 2.9 years ago • written 2.9 years ago by chen2.1k
gravatar for cpad0112
2.9 years ago by
cpad011214k wrote:

search for sequence motifs in bam: qmotif ( and output is bam with matching reads and xml file with matching information.

ADD COMMENTlink written 2.9 years ago by cpad011214k
gravatar for dariober
2.9 years ago by
WCIP | Glasgow | UK
dariober11k wrote:

One more answer... If you are interested in visually inspecting these reads, the program I've written, ASCIIGenome, has a command, filterVariantReads, to filter for reads that are variant at a given position or interval.

So, first load genome and data:

ASCIIGenome -fa genome.fa aln.bam

Go to region of interest and filter for variant reads, say your SNP is at position chr7:150

goto chr7:100
filterVariantReads -r 150

You can then save the selected reads to file with the print command.

ADD COMMENTlink modified 2.9 years ago • written 2.9 years ago by dariober11k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1374 users visited in the last hour