Question: Find chromosome number
0
gravatar for bulbul
4 months ago by
bulbul10
bulbul10 wrote:

How to find out the chromosome position of each sequence of the sample?

Thanks in advance

Sequence    CloneID Chromosome  ChromosomePosition
TGCAGTTATTTGGCTCATCGTCGTATTGCAAGTTTCTGACATCGCTGTACACTGTTGACGTCGCCGAGA   1106145|F|0 contig103705_ln_2374_nr_121_    2005
TGCAGGGCCGCCATGCCACCGAGTCTGGCGTGATCAAAGGTTCTATCTCGCTGAAACCCAGCAGCATGC   1129425|F|0     0
TGCAGCATGCCCACTACCGGTGTCGCCACCACCAGGAGACCATCGCTGCACCACCTTGACCTCGAGGGA   2291218|F|0 contig498398_ln_1385_nr_68_ 856
TGCAGGAGGCTAACCCGCCCCTTGCCGCTTGCGACCGAGCAGCGTCGACTGCCGAGATCGGAAGAGCGG   1132446|F|0 contig137613_ln_2176_nr_31_ 1949
TGCAGATCTTCTGTGCAAGGGACATTTTGCTGGTATGAGGAGACGTGGCCGAGATCGGAAGAGCGGTTC   1091859|F|0     0
TGCAGCAAACAGCTAGGGATTGGAGGTTGGATCGAGCAGCGGTGTGTCACCATGGGGTGGAAGCAGGCG   2261700|F|0     0
TGCAGCGCCAAATAGGAAATCCCTCGATCCCGTGACCTCCGAGATCGGAAGAGCGGTTCAGCAGGAATG   3023908|F|0     0
TGCAGTTGCTCACAGCTACGCGCGGCCCGCCGCTGCCAGACTTGCCTGCGCGCCGCCGCTATAAGCGGT   1865033|F|0     0
TGCAGGAAAACCATTGGCAGAAGAAAGGAAATGCCGTGCATGATTAATTACAAGTTACTTTGACAACAT   1099562|F|0 contig281739_ln_1723_nr_39_ 274
TGCAGTATGAATGGGTGCACTGTGAATTGGTGGTTTTGTAGGTTACCTTCCGAGATCGGAAGAGCGGTT   1126109|F|0 contig365276_ln_1565_nr_26_ 104
TGCAGCCACTTGTGGCCCTTGGATGTCGTCGCTATAGAGGTCGAGGTACTTGACGGCGAGATGATGTGG   2253584|F|0     0
TGCAGTACATGCATGTCAGAATTATCATCATGCGAGCTCAAGTATAGACTGTGTAGTCAAGCACTGCGA   1046540|F|0 contig349609_ln_1590_nr_20_ 409
TGCAGCGACAGAGATGGCCTGTGCCTGCCTCGTCTTGAACTCGACCATCCTATTAACGCCCGAGATCGG   100012515|F|0   contig129313_ln_2223_nr_42_ 1600
TGCAGGGAGCCGTCGCGCAGCAGCTGGAGCGCGCGTTCGCGGCGAACGAGCCTTCCGACGACTCAGCGT   1209933|F|0     0
chromosome R perl • 237 views
ADD COMMENTlink modified 4 months ago by rse70 • written 4 months ago by bulbul10

Please choose the correct tag. This is a regular question, not a job advert. For now, I've changed it for you.

ADD REPLYlink modified 4 months ago • written 4 months ago by Jean-Karim Heriche18k

What about aligning the sequences to the reference genome of your choice ?

ADD REPLYlink written 4 months ago by Jean-Karim Heriche18k

Maybe related post:

ADD REPLYlink written 4 months ago by zx87546.6k
1
gravatar for rse
4 months ago by
rse70
Singapore
rse70 wrote:

You can perform NCBI-BLAST or do UCSC BLAT

ADD COMMENTlink written 4 months ago by rse70
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 695 users visited in the last hour