standalone blast output to excel
0
0
Entering edit mode
5.6 years ago
shuksi1984 ▴ 60

I want the standalone blast output in a specific format, which needs to have only aligned sequence the corresponding sequence id . Hence, is it possible to dump standalone blast output to excel?

alignment genome sequence • 2.5k views
ADD COMMENT
1
Entering edit mode

Yes, just use -outfmt 6 or -outfmt 10 for tab or comma separated values and import to excel accordingly. You also need to define the output fields you're interested in. You can see all options with blastn -help

ADD REPLY
0
Entering edit mode

which needs to have only aligned sequence the corresponding sequence id.

Could you please explain more ?

ADD REPLY
0
Entering edit mode

Following should be the content of excel:

Score   Expect  Identities  Gaps    Strand
6.684e+06 bits(3619559)     0.0     3619559/3619559(100%)   0/3619559(0%)   Plus/Plus

Query  1       
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct  1 
TACCATTTGAGTATTTCTGAATTTAGGTATTTATTTTCGCGTTCGTATAGAAATACTCCA  60
ADD REPLY
0
Entering edit mode

you can indeed (as 5heikki says) get this from the tabular blast output. It might/will require some reformatting though as you will get all on a single line from blast

ADD REPLY

Login before adding your answer.

Traffic: 1902 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6