Entering edit mode
4.4 years ago
taheri.sadegh
•
0
hi Friends How to convert SNP name to SNP chip 50k illumina to rs number?Thanks everyone
hi Friends How to convert SNP name to SNP chip 50k illumina to rs number?Thanks everyone
the first line of the file:
$ cat OvineSNP50_B2.csv | tail -n+8 | cut -d, -f 9- | head -n 2
GenomeBuild,Chr,MapInfo,Ploidy,Species,Source,SourceVersion,SourceStrand,SourceSeq,TopGenomicSeq,BeadSetID,Exp_Clusters,Intensity_Only,RefStrand
Oar_v4.0,15,5859890,diploid,other,pilot,0,BOT,NNNNNNNNNNNNNNNNCTGCTTCCGTATTTGGGTCTTCTCTCAACTTCTCTTCTTCTCCC[T/C]TGCTGAGGAGGAGGCACTTTCAGATGTATTATGTTAATGGAGAGAAAAAGCATAATATTG,CAATATTATGCTTTTTCTCTCCATTAACATAATACATCTGAAAGTGCCTCCTCCTCAGCA[A/G]GGGAGAAGAAGAGAAGTTGAGAGAAGACCCAAATACGGAAGCAGNNNNNNNNNNNNNNNN,143,3,0,-
is found in dbsnp : rs55630613
$ wget -O - -q "ftp://ftp.ncbi.nih.gov/snp/organisms/archive/sheep_9940/VCF/vcf_chr_15.vcf.gz" | gunzip -c | awk '($1==15 && $2==5859890)'
15 5859890 rs55630613 C T . . RSPOS=5859890;GENEINFO=101120860:TMEM123;dbSNPBuildID=128;SAO=0;VC=snp;VLD;VP=050000800005000000000100
you could automatize this using linux join...
Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Unless you post an example it is not possible for anyone to help you. If you look to the right of your own post --> there is a column of
similar posts
. It is possible that there is already something there that can help you. Here is one example: rs(number) of a SNPThanks for your guidance
Chromosome coordinates and ref allele (and alt) determine the rs ID when matching SNVs. Get your SNPs either in text, bed format or in VCF format . Then intersect with dbSNP vcf or use it with online interpretation such as VEP.
Thankful But the file format I have is csv. Do you have a solution for this format?
As said https://www.biostars.org/u/18713/:
csv can be anything, it simply indicates the delimiter. Please post data!
The URL of the site I downloaded the file from. But the snp inside it is not an rs number.
That is fine but people will need to see an example of what your data looks like to be able to give you an exact answer.
csv
is a generic format and your file may have 2 or 100 columns. We don't know what they are.Can you show the output of
head -5 yourfile.csv
?https://support.illumina.com/array/array_kits/ovinesnp50_dna_analysis_kit/downloads.html The URL of the site I downloaded the file from. But the snp inside it is not an rs number.
I believe DN-kit studio may help: https://dnagenics.com/convert-dante-labs-to-23andme-raw-file/