Tutorial: STARsolo config for 10x Chromium v1, v2, v3
5
gravatar for Kevin Blighe
5 weeks ago by
Kevin Blighe66k
Kevin Blighe66k wrote:

Instigated due to another question: RNA-Seq Cell Barcode Whitelist 10X

I am adding this for the benefit of others, as there is no other resource where the following information is clearly stated, from what I have found.

These are useful for STARsolo parameter configurations when re-aligning 10X Chromium FASTQs.

10x v1

  • Whitelist, 737K-april-2014_rc.txt
  • CB length, 14
  • UMI start, 15
  • UMI length, 10 (courtesy ATpoint)

10X v2

  • Whitelist, 737K-august-2016.txt
  • CB length, 16
  • UMI start, 17
  • UMI length, 10

10x v3

  • Whitelist, 3M-Feb_2018_V3.txt
  • CB length, 16
  • UMI start, 17
  • UMI length, 12

As per ATpoint, whitelists are available from: https://github.com/10XGenomics/cellranger/tree/master/lib/python/cellranger/barcodes

These are implemented in STAR as:

  STAR \
    ...
    --soloCBwhitelist [whitelist] \
    --soloCBlen [CB length] \
    --soloUMIstart [UMI start] \
    --soloUMIlen [UMI length] \
    ...

Technically, STARsolo can also be run with --soloCBwhitelist None if no whitelist is provided.

Kevin

ADD COMMENTlink modified 5 weeks ago • written 5 weeks ago by Kevin Blighe66k
1

Here is a link to the old v1 chemistry datasheet. If I get that correctly the "UMI" as it is called today was 10bp and called a "randomer" back in the day.

ADD REPLYlink written 5 weeks ago by ATpoint40k

I got data for 10X processed in Nextseq. It uses Chromium Next GEM Single Cell 3' GEM, Library Kit v3.1 but has 27 bases in R1 reads- (CCTTTCAGTCGCATCGGAACCCACTGC) White list (Whitelist, 3M-Feb_2018_V3.txt) AAACCCAAGAAACACT I also tried version 2 and without Whitelist, but still, it will not work. Any suggestion that what may be wrong in barcode specifications and read length?

ADD REPLYlink modified 4 weeks ago • written 4 weeks ago by kanwarjag1.1k

Looks like your sequencing facility sequenced R1 one base pair-short. I guess you can try specifying --soloBarcodeReadLength 27.

ADD REPLYlink written 4 weeks ago by genomax91k

Unfortunately https://singlecell.usegalaxy.eu/ it will not let me fine tune such parameters.

ADD REPLYlink written 4 weeks ago by kanwarjag1.1k

Looks like you will have to run this on the command line in that case.

ADD REPLYlink written 4 weeks ago by genomax91k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1225 users visited in the last hour