Remove header from cDNA.fa file
0
0
Entering edit mode
12 months ago
harry ▴ 30

I have cDNA.fa file and i want to remove all header except the ENST name so how can i remove it. I don't want loose any cDNA sequence .In advance thanks

>ENST00000390567.1 cdna chromosome:GRCh38:14:105881034:105881053:-1 gene:ENSG00000211907.1 gene_biotype:IG_D_gene transcript_biotype:IG_D_gene gene_symbol:IGHD1-2
6 description:immunoglobulin heavy diversity 1-26 [Source:HGNC Symbol;Acc:HGNC:5485]
GGTATAGTGGGAGCTACTAC
>ENST00000452198.1 cdna chromosome:GRCh38:14:105881539:105881556:-1 gene:ENSG00000225825.1 gene_biotype:IG_D_gene transcript_biotype:IG_D_gene gene_symbol:IGHD6-2
5 description:immunoglobulin heavy diversity 6-25 [Source:HGNC Symbol;Acc:HGNC:5516]
GGGTATAGCAGCGGCTAC
>ENST00000390569.1 cdna chromosome:GRCh38:14:105883903:105883922:-1 gene:ENSG00000211909.1 gene_biotype:IG_D_gene transcript_biotype:IG_D_gene gene_symbol:IGHD5-2
4 description:immunoglobulin heavy diversity 5-24 (non-functional) [Source:HGNC Symbol;Acc:HGNC:5510]
GTAGAGATGGCTACAATTAC
>ENST00000437320.1 cdna chromosome:GRCh38:14:105884870:105884888:-1 gene:ENSG00000227196.1 gene_biotype:IG_D_gene transcript_biotype:IG_D_gene gene_symbol:IGHD4-2
3 description:immunoglobulin heavy diversity 4-23 (non-functional) [Source:HGNC Symbol;Acc:HGNC:5504]
TGACTACGGTGGTAACTCC
>ENST00000390571.1 cdna chromosome:GRCh38:14:105886031:105886061:-1 gene:ENSG00000211911.1 gene_biotype:IG_D_gene transcript_biotype:IG_D_gene gene_symbol:IGHD3-2
2 description:immunoglobulin heavy diversity 3-22 [Source:HGNC Symbol;Acc:HGNC:5497]
GTATTACTATGATAGTAGTGGTTATTACTAC

I want look my file like this---

>ENST00000390567.1 
GGTATAGTGGGAGCTACTAC
>ENST00000452198.1 
GGGTATAGCAGCGGCTAC
cDNA fasta header remove • 255 views
ADD COMMENT
2
Entering edit mode
cut -d ' ' -f1 in.fa
ADD REPLY
0
Entering edit mode

If the headers are single line and sequences have no space in between, try this: awk -F " " '{print $1}' test.fa or sed '/^>/ s/\s.*//g' test.fa

ADD REPLY

Login before adding your answer.

Traffic: 1890 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6