Question: Rearranging Dna Sequences
gravatar for Jess
9.0 years ago by
Jess10 wrote:

I'm having trouble rearranging a DNA sequence. I need to rearrange randomly a given DNA sequence so the G/C content remains the same and so does the A/T content and therefore the length. I can generate random sequences but I cannot rearrange a given sequence randomly.

Any help would be great thanks.

perl python dna R • 5.5k views
ADD COMMENTlink modified 9.0 years ago by Larry_Parnell16k • written 9.0 years ago by Jess10

homework ?.....

ADD REPLYlink written 9.0 years ago by Pierre Lindenbaum118k

Sounds like . . .

ADD REPLYlink written 9.0 years ago by Jarretinha3.3k

Duplicate of

ADD REPLYlink written 7.8 years ago by Martin A Hansen3.0k
gravatar for Marcos De Carvalho
9.0 years ago by
Porto Alegre, RS, Brasil
Marcos De Carvalho310 wrote:

shuffleseq from EMBOSS shuffles a set of sequences maintaining composition.

ADD COMMENTlink written 9.0 years ago by Marcos De Carvalho310

One can even use web:

ADD REPLYlink written 9.0 years ago by Darked894.2k

I second the use of shuffleseq.

ADD REPLYlink written 9.0 years ago by Neilfws48k
gravatar for brentp
9.0 years ago by
Salt Lake City, UT
brentp22k wrote:

here's a function in python that "mutates" the original sequence, maintaining gc, at content.

import random

def seq_shuffler(original_seq="ACCAACXTGGGGTTTCCGGGGCCCCC"):
    original_seq = list(original_seq)
    while True:
        yield "".join(original_seq)

random_seq_gen = seq_shuffler()

# or loop.
for k in random_seq_gen:
    print k
ADD COMMENTlink modified 6 months ago by RamRS20k • written 9.0 years ago by brentp22k

Nice example. I haven't really done much with Python yet, but the various examples I've seen on this site have convinced me to take a look at it. For the things I don't do with R I tend to use Perl.

ADD REPLYlink written 9.0 years ago by Ian Simpson910

uShuffle can produce a Perl module, and a Python too. I generally add it to my bioperl/biopython stuff. And it is time and memory efficient.

ADD REPLYlink written 9.0 years ago by Jarretinha3.3k
gravatar for Ian Simpson
9.0 years ago by
Ian Simpson910
Ian Simpson910 wrote:

OK I got a bit obsessed with doing this in R because I thought you could do it in one line, which you can !! (not including the input that is)

#input string of choice
a <- 'agcactacgactacgacagcata';

#shuffle it

and to do this 100 times and print out the answer:-

for(i in 1:100){
ADD COMMENTlink modified 6 months ago by RamRS20k • written 9.0 years ago by Ian Simpson910

not bad! though that's a large value of 1. ;) the python version could also be "1" line.

ADD REPLYlink written 9.0 years ago by brentp22k

five concatenated functions that's what R lives on !!! ;)

ADD REPLYlink written 9.0 years ago by Ian Simpson910
gravatar for Rob Syme
9.0 years ago by
Rob Syme530
Perth, Western Australia
Rob Syme530 wrote:

While the EMBOSS solution is probably the best, if it needs to be incorporated into a script, the Bioruby library gives you the very convenient 'randomize' method:

require 'bio'
s.randomize         # ==> "tagccggcctxgatcactgcgcgccg"
ADD COMMENTlink modified 6 months ago by RamRS20k • written 9.0 years ago by Rob Syme530
gravatar for Chris Miller
9.0 years ago by
Chris Miller20k
Washington University in St. Louis, MO
Chris Miller20k wrote:

What language are you using? Here's something in Ruby:

class Array
  #fisher-yates/knuth shuffle
  def shuffle!
    n = length
    for i in 0...n
      r = Kernel.rand(n-i)+i
      self[r], self[i] = self[i], self[r]

  # Return a shuffled copy of the array
  def shuffle



As always, there may be a more concise way to do this, but this will get the job done.

ADD COMMENTlink modified 6 months ago by RamRS20k • written 9.0 years ago by Chris Miller20k

I think the EMBOSS shuffleseq is the better solution, but if you really want to use ruby, the bioruby library gives you a convenient 'randomize' method:

require 'bio'
s.randomize    #=> "tagccggcctxgatcactgcgcgccg"
ADD REPLYlink modified 6 months ago by RamRS20k • written 9.0 years ago by Rob Syme530
gravatar for Jarretinha
9.0 years ago by
São Paulo, Brazil
Jarretinha3.3k wrote:

Hi Jess,

You can use Sean Eddy's Squid lib from Sean Eddy to do this. It's will generate a set of command-line application able to shuffle you sequence in several ways. Additionally, you can use uShuffle which will do a similar job. Both can shuffle preserving the base counts and preserving n-base (dibase, tribase, etc.) counts too.

ADD COMMENTlink written 9.0 years ago by Jarretinha3.3k
gravatar for Panagiotis Alexiou
8.5 years ago by
Athens, Greece
Panagiotis Alexiou200 wrote:

also in perl without modules

my $seq = "AAAAAGTATACAACATCA"; #input seq
my @seqarray = split(//,$seq); #put seq in array
my @randarray = sort {rand() <=> rand()} @seqarray; #suffle indexes
my $outseq = join("",@randarray); #join shuffled sequence
print "$outseq\n"; #output

note that the perl sort function compares 2 numbers by <=> and returns -1, 0 or 1 depending which one is larger. if you sort by rand()<=>rand() then the sorting is random.

ADD COMMENTlink modified 6 months ago by RamRS20k • written 8.5 years ago by Panagiotis Alexiou200
gravatar for Ian Simpson
9.0 years ago by
Ian Simpson910
Ian Simpson910 wrote:

If you fancy doing it in Perl there are three different ways you can try listed here :-

ADD COMMENTlink written 9.0 years ago by Ian Simpson910
gravatar for Larry_Parnell
8.5 years ago by
Boston, MA USA
Larry_Parnell16k wrote:

There are a whole set of web-based tools available for this at This would be fine for the one-off or small set of sequences or for one who does not run perl or have access to tools found at a large institution. Nonetheless, the code examples above are also a way to learn...

ADD COMMENTlink written 8.5 years ago by Larry_Parnell16k
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1485 users visited in the last hour