Rearranging Dna Sequences
Entering edit mode
14.2 years ago
Jess ▴ 10

I'm having trouble rearranging a DNA sequence. I need to rearrange randomly a given DNA sequence so the G/C content remains the same and so does the A/T content and therefore the length. I can generate random sequences but I cannot rearrange a given sequence randomly.

Any help would be great thanks.

python dna perl r • 8.4k views
Entering edit mode

homework ?.....

Entering edit mode

Sounds like . . .

Entering edit mode
Entering edit mode
14.2 years ago

shuffleseq from EMBOSS shuffles a set of sequences maintaining composition.

Entering edit mode

One can even use web-based shuffleseq

Entering edit mode

I second the use of shuffleseq.

Entering edit mode
14.2 years ago
brentp 24k

here's a function in python that "mutates" the original sequence, maintaining gc, at content.

import random

def seq_shuffler(original_seq="ACCAACXTGGGGTTTCCGGGGCCCCC"):
    original_seq = list(original_seq)
    while True:
        yield "".join(original_seq)

random_seq_gen = seq_shuffler()

# or loop.
for k in random_seq_gen:
    print k
Entering edit mode

Nice example. I haven't really done much with Python yet, but the various examples I've seen on this site have convinced me to take a look at it. For the things I don't do with R I tend to use Perl.

Entering edit mode

uShuffle can produce a Perl module, and a Python too. I generally add it to my bioperl/biopython stuff. And it is time and memory efficient.

Entering edit mode
14.2 years ago
Ian Simpson ▴ 960

OK I got a bit obsessed with doing this in R because I thought you could do it in one line, which you can !! (not including the input that is)

#input string of choice
a <- 'agcactacgactacgacagcata';

#shuffle it

and to do this 100 times and print out the answer:-

for(i in 1:100){
Entering edit mode

not bad! though that's a large value of 1. ;) the python version could also be "1" line.

Entering edit mode

five concatenated functions that's what R lives on !!! ;)

Entering edit mode
14.2 years ago
Rob Syme ▴ 540

While the EMBOSS solution is probably the best, if it needs to be incorporated into a script, the Bioruby library gives you the very convenient 'randomize' method:

require 'bio'
s.randomize         # ==> "tagccggcctxgatcactgcgcgccg"
Entering edit mode
14.2 years ago

What language are you using? Here's something in Ruby:

class Array
  #fisher-yates/knuth shuffle
  def shuffle!
    n = length
    for i in 0...n
      r = Kernel.rand(n-i)+i
      self[r], self[i] = self[i], self[r]

  # Return a shuffled copy of the array
  def shuffle



As always, there may be a more concise way to do this, but this will get the job done.

Entering edit mode

I think the EMBOSS shuffleseq is the better solution, but if you really want to use ruby, the bioruby library gives you a convenient 'randomize' method:

require 'bio'
s.randomize    #=> "tagccggcctxgatcactgcgcgccg"
Entering edit mode
14.2 years ago

Hi Jess,

You can use Sean Eddy's Squid lib from Sean Eddy to do this. It's will generate a set of command-line application able to shuffle you sequence in several ways. Additionally, you can use uShuffle which will do a similar job. Both can shuffle preserving the base counts and preserving n-base (dibase, tribase, etc.) counts too.

Entering edit mode
13.7 years ago

also in perl without modules

my $seq = "AAAAAGTATACAACATCA"; #input seq
my @seqarray = split(//,$seq); #put seq in array
my @randarray = sort {rand() <=> rand()} @seqarray; #suffle indexes
my $outseq = join("",@randarray); #join shuffled sequence
print "$outseq\n"; #output

note that the perl sort function compares 2 numbers by <=> and returns -1, 0 or 1 depending which one is larger. if you sort by rand()<=>rand() then the sorting is random.

Entering edit mode
14.2 years ago
Ian Simpson ▴ 960

If you fancy doing it in Perl there are three different ways you can try listed here

Entering edit mode
13.7 years ago

There are a whole set of web-based tools available for this at This would be fine for the one-off or small set of sequences or for one who does not run perl or have access to tools found at a large institution. Nonetheless, the code examples above are also a way to learn...


Login before adding your answer.

Traffic: 1534 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6