Question: Visualizing Bowtie Output In Genome Browser
0
gravatar for k.nirmalraman
6.7 years ago by
k.nirmalraman1.0k
Germany
k.nirmalraman1.0k wrote:

I received a text file which has following entries and I assume this is a Bowtie aligned map files and I would like to visualize the same on a local genome browser.

HWI-ST863:202:C2014ACXX:4:1101:2197:1894 1:N:0:NTTTTTCG + NM_011363 3354 TGTTGTTGTTGTTTTAAACAAAATGGAAAAGCATAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 1

HWI-ST863:202:C2014ACXX:4:1101:3133:1962 1:N:0:NAATAAGA + NM_175190 729 GTGTGGTTGTCCCTTTTGTTAATAAACATATGAGCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0

HWI-ST863:202:C2014ACXX:4:1101:5688:1889 1:N:0:NTATCTGG + NM_020606 4378 CTGTCTTGATCCATTTCTTCTGCATGATTCCAGAAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0

HWI-ST863:202:C2014ACXX:4:1101:9703:1907 1:N:0:NTTAAAGG + NM_026030 397 GCTTCTGATGACTTAGATGATTTGAACTTCTTTAAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0

I would like to validate if the reads are enriched towards the 3' end of the mRNA (genes). I would also like a local genome browser like tool for this purpose. How can I see this in a genome browser like IGV?

visualization bowtie • 3.5k views
ADD COMMENTlink modified 6.7 years ago by Alex Reynolds29k • written 6.7 years ago by k.nirmalraman1.0k

I guess I should some how convert this file to bed format...

ADD REPLYlink written 6.7 years ago by k.nirmalraman1.0k

I don't quite understand the question. But if you just want to visualize the bam file, you can load the BAM file in IGV browser. And you can load your reference genome as well and just focus on the region you are interested in.

ADD REPLYlink written 6.7 years ago by Jordan1.1k

I tried to load this file directly into IGV from file-> load file with mouse genome as reference, but I cannot see anything beyond that

ADD REPLYlink written 6.7 years ago by k.nirmalraman1.0k

Does your BAM file have an index file? I think IGV usually needs it.

ADD REPLYlink modified 6.7 years ago • written 6.7 years ago by Jordan1.1k

You also need to have the same chromosome name between the bam and your reference sequence

ADD REPLYlink modified 6.7 years ago • written 6.7 years ago by Nicolas Rosewick8.6k

I don't have a index file, but here it says, I should have a sorted file. I tried IGV tools for sorting but no succes. File type or sorting not supported error... which leaves me wondering, if the file is in bam format....

ADD REPLYlink written 6.7 years ago by k.nirmalraman1.0k

you can use samtools for sorting the bam file.

samtools sort file.bam file.sorted

then, index the bam file (Note: to index the bam file, the file needs to be sorted beforehand).

samtools index file.sorted.bam
ADD REPLYlink modified 6.7 years ago • written 6.7 years ago by Jordan1.1k
1
gravatar for Alex Reynolds
6.7 years ago by
Alex Reynolds29k
Seattle, WA USA
Alex Reynolds29k wrote:

Convert your sequences to FASTA and run them through, for example, a command-line instance of UCSC BLAT to get a PSL file. Run the PSL file through BEDOPS psl2bed to get a BED file. You can turn this into a BED-like BedGraph file pretty easily for uploading to and visualization with a, for example, local UCSC Genome Browser instance.

ADD COMMENTlink modified 6.7 years ago • written 6.7 years ago by Alex Reynolds29k
0
gravatar for swbarnes2
6.7 years ago by
swbarnes27.2k
United States
swbarnes27.2k wrote:

For starters, can you convert that to .bam format? (Or to .sam, which can then be converted to .bam)

Bams don't have '+' to indicate the strand, it's in the flag value instead.

ADD COMMENTlink written 6.7 years ago by swbarnes27.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1649 users visited in the last hour