Finding Adapters For Illumina Reads
Entering edit mode
10.6 years ago
figo ▴ 220

Hi All

I have some illumina reads but I don't know which adapters has been used. How I can find if my illumina reads has adapters and of which type.


fastqc • 18k views
Entering edit mode

hi, I have the same problems, how do you resolve it?

Entering edit mode
10.6 years ago
Phil S. ▴ 700


imprt them into the FastQC program. Go for "overrepresented sequences" there should be stated which adaptors are used.

Entering edit mode

That will only happen if there is adapter contamination. Usually that is not the case, as people always try and sequence a fragment longer than the read length

Entering edit mode
10.6 years ago
rtliu ★ 2.2k

FastQC only gave you warning when overrepresented sequences were in first 200,000 sequences. see FastQC documentation

Supposed read1.fastq and read2.fastq is the paired end data with 4 lines per read.

Download common Illumina adapters from

Go through each adapter, e.g. sampling 1 million read1.fastq for truseq-forward-contam adapter:

cat read1.fastq | head -4000000 | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l 
cat read1.fastq | tail -4000000 | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l

If the above command output >100, then sampling 1 million read2.fastq for truseq-reverse-contam will output with similar number:

cat read2.fastq | head -4000000 | grep AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA| wc -l 
cat read2.fastq | tail -4000000 | grep AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA| wc -l
Entering edit mode

no need for cat imho:

head -4000000 read1.fastq | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l

Entering edit mode
10.0 years ago
rse ▴ 100

In reference to the comment above, i tried the following commands:

cat read1.fastq | head -4000000 | grep <Adaptersequence> | wc -l 
cat read1.fastq | tail -4000000 | grep <Adaptersequence> | wc -l

on my fastq file and got different output numbers (2731 and 1818 respectively).

What does this signify?

Entering edit mode

Means your forward reads have 2731 adapters in them and reverse have 1818. The numbers do not have to be identical.

Entering edit mode
10.0 years ago
Irsan ★ 7.8k

You can find the illumina adapters on the illumina website.

Entering edit mode

The link doesn't work.


Login before adding your answer.

Traffic: 2366 users visited in the last hour
Help About
Access RSS

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6