Question: Converting ION torrent .BAM to Fastq
2
gravatar for alok.helix
5.8 years ago by
alok.helix80
India
alok.helix80 wrote:

Hello Colleagues,

I have a set of files generated by ion torrent server. It seems that the server produces a fastq file in the BAM format. I am quite surprised because I have been using an Illumina dataset, which produces a fastq file. The BAM of PGM looks quite different in comparison to the Illumina bam file(samtools view -H ion.bam), Any suggestions how to generate a Fastq from this bam.

Thank you

ADD COMMENTlink modified 5.8 years ago by biocyberman810 • written 5.8 years ago by alok.helix80
1

Try http://broadinstitute.github.io/picard/command-line-overview.html#SamToFastq

ADD REPLYlink written 5.8 years ago by Ashutosh Pandey12k

Dear Ashutosh, please see the above illustrated file!! It looks notthings like a BAM to me....Where is the CIGAR and all the relevant fields??

ADD REPLYlink written 5.8 years ago by alok.helix80

Can you please post a few example lines of the BAM data?

ADD REPLYlink written 5.8 years ago by Dan D7.2k

@HD    VN:1.4    SO:coordinate
@RG    ID:1F9VX.IonXpress_010    PL:IONTORRENT    PU:Unspecified/314R/IonXpress_010    FO:TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGA    DS:Running 1 DMD 1 Lung and Colon 1 E coli and 1 BCRABL Sample    DT:2015-04-16T19:57:17+0530    SM:E_Coli MDR    KS:TCAGCTGACCGAACGAT    CN:TorrentServer/sn11c061316
@PG    ID:bc    PN:BaseCaller    VN:4.2-18/6b3fd1b    CL:BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 20 --calibration-file basecaller_results/recalibration/hpTable.txt --phase-estimation-file basecaller_results/recalibration/BaseCaller.json --model-file basecaller_results/recalibration/hpModel.txt --input-dir=sigproc_results --librarykey=TCAG --tfkey=ATCG --run-id=1F9VX --output-dir=basecaller_results --block-col-offset 0 --block-row-offset 0 --datasets=basecaller_results/datasets_pipeline.json --trim-adapter ATCACCGACTGCCCATAGAGAGGCTGAGAC
@CO    {"1F9VX.block_X0_Y0":{"flowEnd":499,"flowSpan":250,"flowStart":0,"max_hp_calibrated":12,"modelParameters":[{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":0,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":0.9923999905586243,"paramB":0.0,"refHP":1,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":0.7135999798774719,"paramB":0.4217000007629395,"refHP":2,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":0.8190000057220459,"paramB":0.3619999885559082,"refHP":3,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.236700057983398,"paramB":-1.080600023269653,"refHP":4,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":5,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":6,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":7,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":8,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":9,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":10,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":65,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":11,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":0,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":0.9915999770164490,"paramB":0.0,"refHP":1,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":0.9466999769210815,"paramB":0.0,"refHP":2,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":0.7113000154495239,"paramB":0.6338999867439270,"refHP":3,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":4,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":5,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":6,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":7,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":8,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":9,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":10,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":67,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":11,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":71,"flowEnd":249,"flowStart":0,"paramA":1.0,"paramB":0.0,"refHP":0,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":71,"flowEnd":249,"flowStart":0,"paramA":0.9603000283241272,"paramB":0.0,"refHP":1,"xMax":639,"xMin":0,"yMax":575,"yMin":0},{"flowBase":71,"flowEnd":249,"flowStar

It goes on & on like this!!! & ends like below

.0,"paramB":0.0,"refHP":11,"xMax":1279,"xMin":640,"yMax":1151,"yMin":576}],"xMax":1279,"xMin":0,"xSpan":640,"yMax":1151,"yMin":0,"ySpan":576},"MagicCode":"6d5b9d29ede5f176a4711d415d769108","MasterCol":0,"MasterKey":"1F9VX.block_X0_Y0","MasterRow":0}
@CO    {"BeadAdapters":{"Adapter_0":{"adapter_sequence":"ATCACCGACTGCCCATAGAGAGGCTGAGAC"}}}

It seems as per

http://mendel.iontorrent.com/ion-docs/Technical-Note---Transition-from-SFF-to-BAM-format_37421247.html there is no more Fastq!!!

ADD REPLYlink written 5.8 years ago by alok.helix80

Dear alok.helix,

i'm also a user of IonTorrent and i'm quite sure you CAN download fastq from inside IonReporter, if i remember well...

ADD REPLYlink written 5.8 years ago by mauro.castagnetta0

It is phased out!! :(

ADD REPLYlink written 5.7 years ago by alok.helix80
4
gravatar for Kowen
5.8 years ago by
Kowen40
Taiwan/Taipei/ACT Genomics
Kowen40 wrote:

Because Ion torrent uses bam files (unaligned/aligned bam) to store the sequencing machine, flow signal, base caller and aligner information. Especially, flow signal information is very important parameter in Ion torrent variant calling workflow. However, the fastq format could not store such information. If you will call variants using ion torrent data, you are better to the bam files that directly output from torrent suite and use the Torrent Variant Caller. If you will assemble the MDR E.coli genome, you could follow Pgibas's suggestion to convert bam to fastq by the bamtools.

ADD COMMENTlink modified 5.8 years ago • written 5.8 years ago by Kowen40
3
gravatar for biocyberman
5.8 years ago by
biocyberman810
Denmark
biocyberman810 wrote:

If you can use bamToFastq like others have suggested, it is fine. Alternatively you can install FileExporter plugin for TorrentSuite and let it export FASTQ file for you automatically whenever a run is done on Iontorrent. At anytime you can run the FileExporter plugin on an existing analysis. Check this out: http://mendel.iontorrent.com/ion-docs/FileExporter-Plugin.html 

ADD COMMENTlink written 5.8 years ago by biocyberman810
2
gravatar for PoGibas
5.8 years ago by
PoGibas4.8k
Vilnius
PoGibas4.8k wrote:

Sometimes I work with Ion data too. This is example of my original "bam" files generated from the BaseCaller: 

@HD     VN:1.4  GO:none SO:coordinate
@RG     ID:GJPTV.IonXpress_Name  PL:IONTORRENT   PU:Unspecified/P1.1.17/IonXpress_001    FO:TACGT...........TGAGCA      DT:2014-01-22T21:36:11+0200     SM:seq_tissue_1 KS:TCAGCTAAGGTAACGAT     CN:TorrentServer/Proton1
...
@PG     ID:bc.Z PN:BaseCaller   VN:4.2-18/6b3fd1b       CL:BaseCaller --barcode-filter 0.01 --barcode-filter-minreads 10 --keypass-filter on --phasing-residual-filter=2.0 --num-unfiltered 1000 --barcode-filter-postpone 1 --input-dir=sigproc_results --librarykey=TCAG --tfkey=ATCG --run-id=GJPTV --output-dir=basecaller_results --block-col-offset 3864 --block-row-offset 6660 --datasets=basecaller_results/datasets_pipeline.json --trim-adapter ATCACCGACTGCCCATAGAGAGGCTGAGAC
...
@CO     {"BeadAdapters":{"Adapter_0":{"adapter_sequence":"ATCACCGACTGCCCATAGAGAGGCTGAGAC"}}}
...

And this is all get (~200 lines; using samtools view -H), nonetheless their size is ~10Gb. I convert them to usual fastq using bamToFastq from bedtools.

ADD COMMENTlink modified 5.8 years ago • written 5.8 years ago by PoGibas4.8k

Thanks a lot i eventually realized this through number of trials, my reads were not missing and the data was fine. I too converted them to fastq and now am further interested to annotate my data, is there a necessity to prepare contigs.fa of your reads if you have aligned your data against a ref genome and got the bam of ampped reads?

ADD REPLYlink written 5.8 years ago by alok.helix80
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1989 users visited in the last hour
_