Question: Convert A Text File Into A Fasta File
2
gravatar for Zhshqzyc
6.9 years ago by
Zhshqzyc450
Zhshqzyc450 wrote:

Hello, I have a text file likes this:

GTCAAAGATCAGATGGTTGTAGATGTGTGGTGTTATTTCTGAAGCCTCTGTTCAAGGAAGGCAGTTTCTTATGAA

I want to convert it to a fasta file. Can we just manually add a ">" in the fist line?

Thanks

fasta • 65k views
ADD COMMENTlink modified 2.6 years ago by BioApps720 • written 6.9 years ago by Zhshqzyc450

Just adding ">" is not a solution, you need biological identifier!

ADD REPLYlink written 6.9 years ago by Thaman3.2k
3
gravatar for Linda
6.9 years ago by
Linda160
Linda160 wrote:

Yes. With some added text to identify the sequence.

ADD COMMENTlink written 6.9 years ago by Linda160
2
gravatar for Torst
6.9 years ago by
Torst880
Australia
Torst880 wrote:

A good explaination of the FASTA format is here:

http://en.wikipedia.org/wiki/FASTA_format

Some applications will use the word immediately after the ">" symbols as an "ID" so make sure it means something to you. You that you can put multiple sequences in the one file, just start each new one with a ">" line, and use a unique ID for each one.

ADD COMMENTlink written 6.9 years ago by Torst880
2
gravatar for ofanoyi
3.1 years ago by
ofanoyi110
Knoxville
ofanoyi110 wrote:

Probably you have figured it out.

 

http://rocaplab.ocean.washington.edu/tools/genbank_to_fasta

http://molbiol-tools.ca/Convert.htm

http://genome.nci.nih.gov/tools/reformat.html

http://www.hiv.lanl.gov/content/sequence/FORMAT_CONVERSION/form.html

http://www.ebi.ac.uk/Tools/sfc/readseq/

 

ADD COMMENTlink written 3.1 years ago by ofanoyi110
1

Following the second link, I found http://www.ebi.ac.uk/Tools/sfc/emboss_seqret/ which worked for me.

ADD REPLYlink written 22 months ago by ekal10
0
gravatar for BioApps
2.6 years ago by
BioApps720
Spain
BioApps720 wrote:

Yes. As you said, the answer is that simple: simply add '>' at the top of your file. Probably, this is the most simple conversion possible !! :) :)

It is not like converting Fasta back to chromatograms :) :) :)

fasta to scf convertot

 

ADD COMMENTlink written 2.6 years ago by BioApps720

How the hell would you do that, and why? It looks like you would have to make up the intensity values, and again - why?

ADD REPLYlink written 2.6 years ago by Matt Shirley8.6k

Yes. You are right. The values are 'made up'. The program is just a joke. I had available a library that read FASTA and one that generated SCF files. I only spent few minutes to put them together :) :) :)

 

ADD REPLYlink written 2.6 years ago by BioApps720
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 903 users visited in the last hour