Convert A Text File Into A Fasta File
4
2
Entering edit mode
10.9 years ago
Zhshqzyc ▴ 490

Hello, I have a text file likes this:

GTCAAAGATCAGATGGTTGTAGATGTGTGGTGTTATTTCTGAAGCCTCTGTTCAAGGAAGGCAGTTTCTTATGAA

I want to convert it to a fasta file. Can we just manually add a ">" in the fist line?

Thanks

fasta • 111k views
ADD COMMENT
0
Entering edit mode

Just adding ">" is not a solution, you need biological identifier!

ADD REPLY
2
Entering edit mode
10.9 years ago
Torst ▴ 970

A good explaination of the FASTA format is here:

http://en.wikipedia.org/wiki/FASTA_format

Some applications will use the word immediately after the ">" symbols as an "ID" so make sure it means something to you. You that you can put multiple sequences in the one file, just start each new one with a ">" line, and use a unique ID for each one.

ADD COMMENT
3
Entering edit mode
10.9 years ago
Linda ▴ 160

Yes. With some added text to identify the sequence.

ADD COMMENT
0
Entering edit mode
6.6 years ago
BioApps ▴ 790

Yes. As you said, the answer is that simple: simply add '>' at the top of your file. Probably, this is the most simple conversion possible !! :) :)

It is not like converting Fasta back to chromatograms :) :) :)

fasta to scf convertot

ADD COMMENT
0
Entering edit mode

How the hell would you do that, and why? It looks like you would have to make up the intensity values, and again - why?

ADD REPLY
0
Entering edit mode

Yes. You are right. The values are 'made up'. The program is just a joke. I had available a library that read FASTA and one that generated SCF files. I only spent few minutes to put them together :) :) :)

ADD REPLY

Login before adding your answer.

Traffic: 1426 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6