Hey,
i opened cmd and typed C:\Users\yang\Downloads\Compressed\sratoolkit.2.5.0-win64\bin
then i typed fastq-dump -X 5 -Z SRR390728
in cmd i am watching
C:\Users\yang\Downloads\Compressed\sratoolkit.2.5.0-win64\bin\fastq-dump -X 5 -Z
SRR390728
Read 5 spots for SRR390728
Written 5 spots for SRR390728
@SRR390728.1 1 length=72
CATTCTTCACGTAGTTCTCGAGCCTTGGTTTTCAGCGATGGAGAATGACTTTGACAAGCTGAGAGAAGNTNC
+SRR390728.1 1 length=72
;;;;;;;;;;;;;;;;;;;;;;;;;;;9;;665142;;;;;;;;;;;;;;;;;;;;;;;;;;;;;96;;;;(
@SRR390728.2 2 length=72
AAGTAGGTCTCGTCTGTGTTTTCTACGAGCTTGTGTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGT
+SRR390728.2 2 length=72
;;;;;;;;;;;;;;;;;4;;;;3;393.1+4;;5;;;;;;;;;;;;;;;;;;;;;;;;9;;;;;;;464262
(.....)
where i can find the downloaded file???? i was going to download a sra file from GEO.

genomax as you suggested to me already, Fast download of FASTQ files from the European Nucleotide Archive (ENA) is quite applicable
This tutorial also contains a section on how to use the
sratoolkit(prefetchandfastq-dump) efficiently (bottom of the tutorial).