Question: how to extract the longest isoform from trinity outfils
gravatar for wu.zhiqiang.1020
2.3 years ago by
United States
wu.zhiqiang.102020 wrote:

Dear all,

I want to filtered the Trinity outfile for RNAseq assemble. I know this is not the best choice, and there are some scripts online. but they are all not good to use in my data, Could you give me some suggestion on this?

my data like this: (Start with > for name)

TRINITY_DN66086_c0_g1_i1 len=1158 path=[1258:0-49 1259:50-66 1268:67-201 1262:202-225 1267:226-656 1257:657-1157] [-1, 1258, 1259, 1268, 1262, 1267, 1257, -2] CTAGCCTACGGGGCTTTATTGGGTCACTTTTTCCAATCGAGTTTGCGGAAAGGCCTCTTT CGGCGGAGCCCTTACGCCTCGTGAAACGAGATATTCAGGGCTCCCCGAAAGGGCACGGCT


How can I get the longest one for the same gene cluster?


rna-seq assembly • 1.7k views
ADD COMMENTlink modified 10 days ago by Shahzad10 • written 2.3 years ago by wu.zhiqiang.102020

Dear All

I am using "" script

Please help to solve this error. I also have installed the perl module Bio::Index::Fasta but the error is still there.

Can't locate in @INC (you may need to install the Fasta_reader module) (@INC contains: /home/ubuntu/Desktop/isoform/../../PerlLib /home/ubuntu/perl5/lib/perl5 /home/ubuntu/miniconda3/envs/longiso/lib/site_perl/5.26.2/x86_64-linux-thread-multi /home/ubuntu/miniconda3/envs/longiso/lib/site_perl/5.26.2 /home/ubuntu/miniconda3/envs/longiso/lib/5.26.2/x86_64-linux-thread-multi /home/ubuntu/miniconda3/envs/longiso/lib/5.26.2 .) at line 7.
BEGIN failed--compilation aborted at line 7.
ADD REPLYlink modified 10 days ago by genomax69k • written 10 days ago by Shahzad10

Looks like your $PERL5LIB variable is not correctly set. Something like: export PERL5LIB=/path_to/trinity/:${PERL5LIB} would be needed.

ADD REPLYlink written 10 days ago by genomax69k

Or use conda to install the trinity, as it takes full care of dependencies and paths.

ADD REPLYlink written 10 days ago by ATpoint19k

I have trinity installed by conda and trinity is working correctly for assembly

ADD REPLYlink written 10 days ago by Shahzad10
gravatar for h.mon
2.3 years ago by
h.mon26k wrote:
ADD COMMENTlink written 2.3 years ago by h.mon26k

It need other pm file to load and the same time. I find this link. But I have to search other more pm files also thanks

ADD REPLYlink modified 2.3 years ago • written 2.3 years ago by wu.zhiqiang.102020

If you install Trinity correctly and set $TRINITY_HOME, the script should work. Also, when reporting an error, please explain it in more detail - for example, copy the error message.

ADD REPLYlink written 2.3 years ago by h.mon26k

thanks, I find it and make it go through. thanks again

ADD REPLYlink written 2.3 years ago by wu.zhiqiang.102020
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 932 users visited in the last hour