Question: Mismatch and Indel statistics from BAM/SAM file
1
gravatar for sbdk82
21 months ago by
sbdk8240
United States
sbdk8240 wrote:

I am trying to find some statistics of mismatches and indels from SAM/BAM file. The SAM file is generated using BWA. The statistics should include the %mismatch and %indel for each aligned reads. I am wondering if there are any good tools I could use.

sam bam indel • 2.4k views
ADD COMMENTlink modified 8 weeks ago by FatihSarigol110 • written 21 months ago by sbdk8240
3
gravatar for trausch
21 months ago by
trausch1.2k
Germany
trausch1.2k wrote:

You can also try alfred. It needs a sorted & indexed BAM file and the reference genome you used for the alignment.

alfred qc -r <reference.fa> <align.bam>

It computes the error rates you are looking for and some other metrics (insert size, coverage, ...).

ADD COMMENTlink modified 6 months ago • written 21 months ago by trausch1.2k

Is there an executable? I am getting error while compiling.

ADD REPLYlink written 17 months ago by sbdk8240

Yes, there are statically compiled binaries available here and we did run it previously on Nanopore, Illumina and PacBio reads but if you experience any problems please let me know.

ADD REPLYlink modified 17 months ago • written 17 months ago by trausch1.2k

It worked fine except the BAM files generated by LAST

ADD REPLYlink written 17 months ago by sbdk8240

Looks nice, did you announce it at the Tools section?

ADD REPLYlink written 17 months ago by h.mon23k

Thanks, I have not created a Tools page in Biostars but there is a fairly extensive README on github.

ADD REPLYlink written 17 months ago by trausch1.2k

metrics.tsv should contain all the statistics, right? I am having hard time to read that file. Would it be possible to make it a text file that should contain like the following

....
.....
#Mapped             196263
MappedFraction  0.31431
#MappedRead1    196263
.....
.....
ADD REPLYlink written 17 months ago by brs111110
1

It is a tab-delimited text file. You can use datamash to convert it to row-format:

cat outprefix.metrics.tsv | datamash transpose | column -t

The column-format is useful if you want to compare statistics across multiple samples because you can just concatenate the metrics files.

ADD REPLYlink written 17 months ago by trausch1.2k
1
gravatar for Brian Bushnell
21 months ago by
Walnut Creek, USA
Brian Bushnell16k wrote:

BBMap's Reformat tool can produce some of these statistics:

ehist=<file>            Errors-per-read histogram.
qahist=<file>           Quality accuracy histogram of error rates versus quality score.
indelhist=<file>        Indel length histogram.
mhist=<file>            Histogram of match, sub, del, and ins rates by read location.
ihist=<file>            Insert size histograms.  Requires paired reads interleaved in sam file.
idhist=<file>           Histogram of read count versus percent identity.

BBMap also prints out a summary of match, mismatch, insertion, and deletion rates when it runs. But I think you can get most of what you want with Reformat, particularly, the mhist output.

ADD COMMENTlink written 21 months ago by Brian Bushnell16k

Thanks Brian !! So I can use my existing BAM/SAM files with BBMAP? Could you please help me with the right command?

I am trying this

reformat.sh in=mapped.sam ehist=ehist.txt

But I get a blank file.

ADD REPLYlink modified 21 months ago • written 21 months ago by sbdk8240

That command should be fine. You need to have MD tags in the sam file, but those should be present by default with bwa. I just ran this on a bwa-produced bam file to make sure, and it worked as expected:

reformat.sh in=502930_1127296.bam ehist=ehist.txt
java -ea -Xmx200m -cp /global/projectb/sandbox/gaag/bbtools/jgi-bbtools/current/ jgi.ReformatReads in=502930_1127296.bam ehist=ehist.txt
Executing jgi.ReformatReads [in=502930_1127296.bam, ehist=ehist.txt]

Set error histogram output to ehist.txt
No output stream specified.  To write to stdout, please specify 'out=stdout.fq' or similar.
Found samtools 1.4
Input is being processed as unpaired
Input:                          18069294 reads                  1824440174 bases
Output:                         18069294 reads (100.00%)        1824440174 bases (100.00%)

Time:                           38.741 seconds.
Reads Processed:      18069k    466.41k reads/sec
Bases Processed:       1824m    47.09m bases/sec

Contents of the file:

#Errors Count
0   16190186
1   1414068
2   197871
3   65303
4   31407
5   18726
6   12160
7   8348
8   5873
9   4199
10  2797
11  1875
12  1266
13  742
14  422
15  166
16  40
17  1
18  1

Note that you can write all the histograms at once if you want. Can you run "tail" on the sam file so I can see what a few reads look like?

ADD REPLYlink modified 21 months ago • written 21 months ago by Brian Bushnell16k
0d6893dc-57eb-4eaa-a1ad-406b4528cc6f    0   c12692/f5p5/989 132 60  10S12M1D30M2I9M1I6M2D39M1I10M2I6M1D17M1D12M1D1M2D11M1D10M1I12M1I67M4I21M2D24M2I11M3D18M1I24M1D26M1D11M5D26M1I8M1D2M1D22M1D4M2D25M1D8M1D2M2D33M1D15M4I12M1D22M2I23M2D6M1D4M2D10M1I25M3I5M3I2M1I7M1I22M4I10M3I11M6I4M1I11M1I5M2I4M2I3M1I4M3I3M2I1M4I8M1D7M1I11M2I7M1I17M2I6M1I5M1I1M1I2M2I8M5I24M51S  *   0   0   CATTACGGCCGGAGGGGCAAGCAAAGATTGTGCTCAAGTTGCCCCTGGATGACCCGAGAGGAAGGAGGAGAGGCCTTTCAGGCTGCTGTGGGAATGAACGGTGTGACATCCCGCCACGATGCGGAGGGGACAAGATCGTCGTCGTGGCGACGGCGTCATTATCACGCTCCCACAATAATATCAGCGCAGCCTCCGGCTTTACGGAGCTGCTCAGCGTCAGCTCCGGCGACGACAAGAAGAAGGGCATTGGGTATGGCTACTGCAGGGAGCAGCGGTGGCATGATGCAACGGCGGTGGCAAAGAGGGCAACGGGAGAGCAAAGGCAGCGGCGGTGGTGGCAGAGAGCAGTGGAGGCTACGGCGGCCGTACCAGGCGATGCCGCCGGTCTCATCCCTGCCTACCTGCAACGCCATGCCGTCGTCCTACCCACTGCGTCTCTCTATCCTGCAGCATACCCGCAGAACAAGGACCCTGGATGCAGCATCATGTGAAAAACATCTACGTTAATCTGAGGAGTTGATTGAAGGTGGCCGAAACATGGAGATCAGATGAATTAACATGGTTGATTCGTCAGGACAAGATGATCCACATGCTGCCTTGAGCTGTGCAACAGGACGTGGTGGGATGTGATCGCCCAGTTGTGAACATTATCATCCGTTATGGAATCTATCAATGTGCAAGGGTTGGCCAACAAACTTGACAGATGGATGAGGTGATTAGAACAAGGTTTACAGCTGAAGGAGTGGAGGCGTTTGTTGCGCCTTGTGAGTTCAAAGAGTTGGACTTCAAATTAATAGCGGCAAACGGTGTTTCTATTTTTCGTTTTCTTTCGGTTTTGGTGGAAACAAGGTTGTGAGGTCAGTTTGTTGGAAGAAAGAAAAGAAAAGAAAGAAAAAGAAAAATATCTCGAAAAGAAAAGAAAAGAAGATGGAGCGACAGACCGTGGGTT   *   NM:i:170    MD:Z:3T8^A45^GA7C0A28G17^C17^C12^G1^CC0C0C9^A1A2C2G0C1C1G14A0C0G44G0A0C18G14^TA1G0G32^AGA2G39^A0T23G1^A11^AGCAG1A25G0C5^A2^C22^C2G1^AC25^A8^C2^AC33^A27^G1G43^AG4T1^A2A1^CC0A11T0T8G14T4T4A12G14T5G5G0A40G1C3^G4A3G1A7C15T37G1T0T1C2T4T2    AS:i:524    XS:i:27
d6da0f06-2394-4203-9190-057434731910    0   c74405/f20p10/1109  181 2   12S11M3D3M1I3M1D23M1D7M2I17M1D35M2I18M1I34M1D18M2D24M1D12M1D12M1D6M2D3M5D1M2D5M1D12M1I2M1I25M1I17M2I10M1I3M3I3M1D17M1D23M1I31M2D21M1I25M5I5M2I28M2I5M1I9M2D9M3D19M1I29M1D19M1D43M1D6M1I6M1I11M1I39M3I2M1I6M1I16M1D6M1D9M1I10M1D20M1D8M1D5M4D2M1D3M1I7M1I10M1I12M1I13M2I10M2I10M1I8M3I2M2I8M1D2M1I4M1I12M1I4M1D9M1I14M1I10M2I5M54S   *   0   0   CATTACGGCCGGGGGACACGCAACAGTCAGGGAGGAGGACGGGCGGCGGCGGCTGGAATCCAGCTCAAGCGTCTGGGTCCTTCTCACCCGCTGTACCGTCCCTCAGGCAGCATGCATGTGCCTCACCCTATGCTCCCACGCTGGCCTTCTCTGCGCTTGGTGCATACCTCACATCCTCCTCAACGTCAGGCACCCTCACGACCATGGGATGCTGGCCTCCATCCTTCCCTCATCTCCTGCCCTTGCAGGAAGGAACCACTTCAGCAGCTGCTCATATCTGCCTTGCTCCTTCCAAGGCGCGTCATTTGGCCCCCGCTCGTCTGACGCACATTTATTGACTTCGATCAGGGATTCTTGTCACGGCGTTTGTCAGGAACAGCGGTTGCTTTTGGATGCTTCTCTGGCTGCCATCATCGCCAAGCGCAAGAAATTACCTGTACCTCGGCAGTCTCTTTTGCTTCATCTTCTGGCCTCTCCATTCTTCTCTGGCTGTGCAGCTTTTCCGCTGATCTTGTGCACCAACACGACCTTCATGTTTTGAGCTCTACCTGGGCCTCCTGGACTTTTTGGATATATAGTGTTTGTACCCAGGAGATCATCAGGAGGGCGCACCCAGGGGACCTGGACACATCAGAGCGCGCCTTTGACTCTCATCCTGGGGCTTCGTTGCGGTTCTTGTTCAGATCCTTGTCACAATCCATGATGGAAGAGTGCACAGGAGAATCAGAGACAGGAAGGAAGAGGAAGGGCGGTCTTCACTGGATGGATGGATGGCTGGGATCTGAGAACTATGTTTATTGGGGTCCACTACTACTACTTTCTACTACTAGTGCACCATGTACTCACCAATCCTATAATGCTGTATGCCTACACTAAAGAGACAAGAGAGCTTTGAGCGTAATATTCGATGACTATTTGGGGATAGATATTTTAGTTCTGCACTGTTAAAATCATCAAAATCGTCAAAAAGAGAAGGAATGATGGGAGGCGACAGATAGCA    *   NM:i:192    MD:Z:11^TCG4G1^A23^T24^A1A13G1A5A1C0T0C0A1A7A16G31^C18^GG18A5^C12^G1C1T8^C6^CG3^CACGG1^AC5^G7G15G6G0C18C0G18T1^G15C1^A28G2A22^GC23G0G1G15G10A33G1T0A2^TC0A5T0G1^CCA7G36T0T2^C0C1G8G7^A0C15G0A11G0G6A5^T9A3G0C9T1A0C0C1A20G0A22A10^A4C1^A4G0A13^A4T1A0G0C0T0G3A3A1^T6A1^A0C1A2^CAAC2^T12G20G23T0G6G1A15^C16A1G1G1^A0C8G5A2G0A6G11    AS:i:527    XS:i:522    XA:Z:c18552/f2p10/1085,+123,12S11M3D3M1I3M1D23M1D7M2I17M1D35M2I18M1I34M1D18M2D24M1D12M1D12M1D6M2D3M5D1M2D5M1D12M1I2M1I25M1I17M2I10M1I3M3I3M1D17M1D23M1I31M2D21M1I25M5I5M2I28M2I8M1D16M3D19M1I29M1D19M1D43M1D6M1I6M1I11M1I39M3I2M1I6M1I16M1D6M1D9M1I10M1D20M1D8M1D5M4D2M1D3M1I7M1I10M1I12M3I1M1I9M2I10M2I10M1I8M3I2M2I8M1D2M1I4M1I12M1I4M1D9M1I14M1I10M2I5M54S,194;c76099/f2p9/973,+63,12S11M3D3M1I3M1D23M1D7M2I17M1D35M2I18M1I34M1D18M2D24M1D12M1D12M1D6M2D3M5D1M2D5M1D12M1I2M1I25M1I17M2I10M1I3M3I3M1D17M1D23M1I31M2D21M1I25M5I5M2I28M2I8M1D16M3D19M1I29M1D19M1D43M1D6M1I6M1I11M1I39M3I2M1I6M1I16M1D6M1D9M1I10M1D20M1D8M1D5M4D2M1D3M1I7M1I10M1I12M3I1M1I9M2I10M2I10M1I8M3I2M2I8M1D2M1I4M1I12M1I4M1D9M1I17M69S,190;
ADD REPLYlink modified 17 months ago by genomax62k • written 17 months ago by sbdk8240

I am still getting a blank file. Please check the last two lines of sam file

ADD REPLYlink written 17 months ago by sbdk8240

Is d6da0f06-2394-4203-9190-057434731910 an ID from Nanopore or some other sequencing tech?

ADD REPLYlink written 17 months ago by genomax62k

Yes, it is from nanopore. I am trying to align naopore reads against both illumina and Pacbio contigs

ADD REPLYlink written 17 months ago by sbdk8240

Is this the mismatch profile for every read or the error rate that is originated from the sequencing? Thanks!

ADD REPLYlink written 7 weeks ago by Dogancan30
0
gravatar for FatihSarigol
8 weeks ago by
FatihSarigol110
Durham
FatihSarigol110 wrote:

Try Qualimap2

Qualimap 2: advanced multi-sample quality control for high-throughput sequencing data

ADD COMMENTlink written 8 weeks ago by FatihSarigol110
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 776 users visited in the last hour