Question: Hisat2 aligner problem
1
gravatar for ta_awwad
7 weeks ago by
ta_awwad220
Frankfurt am Main
ta_awwad220 wrote:

Dear All, I am trying to align RNA-seq stranded data with Hisat2 aligner, however the program stuck with no error message nor output sam file. my fastq look like this:

@DD61XKN1:241:C748WACXX:2:1101:1339:1934 1:N:0:TAAGGCGA
NTAGGCACTCGCATTCCACGCCCGGCTCCACGCCAGCGAGCCGGGCTTCT
+
#1:;DDDFHHGHGGIIDGHGG?HGIEEEDFHB@D0@C;/;EAEEECCCAA
@DD61XKN1:241:C748WACXX:2:1101:1335:1958 1:N:0:TAAGGCGA
NACAAGTACATATATCTACACACACACACACACACACACACACACACACA
+
#1::AA2BCC4A<AECGBI<FBF;@G>GIIFEEFE@GEGIIE?6;BFE;D
@DD61XKN1:241:C748WACXX:2:1101:1294:1958 1:N:0:TAAGGCGA
NGACAGATGAAATACCACGGCAGTGAACTGTGAGGTAACTTCCATTTTTT

and my command line is:

hisat2 -p 8 --dta -x /Volumes/hisat.index/mm10  -1 R1.fastq -2 R2.fastq -S R.sam

my index folder contains:

mm10.rf, mm10.1.ht2, mm10.2.ht2, mm10.3.ht2, mm10.4.ht2, mm10.7.ht2, mm10.8.ht2, mm10.exon, mm10.ss

any idea what could be possibly wrong? many many thanks

ADD COMMENTlink modified 7 weeks ago • written 7 weeks ago by ta_awwad220
1

Is this specific of the software, of the dataset or of the index? Try the following:

1) Type hisat2 -h and see if you are able to view the help page

2) Use a different set of reads to align on the same index files, and see if the problem persists.

3) Use your reads and try to align to different index files (even if they are form another species, you just have to test software funcitonality).

ADD REPLYlink modified 7 weeks ago • written 7 weeks ago by Fabio Marroni2.3k

thank you so much 1) checked .. the program works fine. 2) checked .. still the same error with different fastq files .. the files are not the problem. .. if you look at the index folder content i do see files from 1-8 except 5&6 ...is this normal or index problem?

ADD REPLYlink written 7 weeks ago by ta_awwad220

In theory you should have all the files, according to the manual. On the manual page you can find link to several prebuilt indexes, which should work.

ADD REPLYlink written 7 weeks ago by Fabio Marroni2.3k
1

Hello there,

I am currently having what appears to be the same issue with hisat2. the program hangs and give no stdout or stderr, but with an output .sam file that remains at 0 bytes without ever increasing in size no matter how long I wait.

If you found a solution to this issue i'd be very grateful if you could let me know?

ADD REPLYlink written 12 days ago by thomas.welch10

Hi Thomas, there is a problem in the index files for unknown reasons .. the hista2 should produce 8 ".hista2" files but rather generate 6. try to download the prebuild index from hist2 website and it will work back again. good luck

ADD REPLYlink written 7 days ago by ta_awwad220

however the program stuck with no error

Can you paste the logs from the terminal ?

ADD REPLYlink written 7 weeks ago by Vijay Lakhujani4.2k

what do you mean ... i wrote everything that i have from the terminal . the program just cant progress .. you get nothing .. only blinking cursor

ADD REPLYlink written 7 weeks ago by ta_awwad220
1

And is it running? Can you see if it's using resources using (h)top?

ADD REPLYlink written 7 weeks ago by WouterDeCoster40k

yes .. it is running

https://ibb.co/6FfDGVj

ADD REPLYlink modified 7 weeks ago • written 7 weeks ago by ta_awwad220

Then you just have to be patient.

ADD REPLYlink written 7 weeks ago by WouterDeCoster40k

i was patient overnight :)

ADD REPLYlink written 7 weeks ago by ta_awwad220

Alignments to human/mouse genome can take several hours (even with 8 cores) if you have million(s) of reads. Sounds like you are running this job in an interactive mode (blinking cursor, no prompt back) so just be patient. It will finish in time.

ADD REPLYlink modified 7 weeks ago • written 7 weeks ago by genomax69k

it was running overnight for 50 million reads only

ADD REPLYlink modified 7 weeks ago • written 7 weeks ago by ta_awwad220

This is kind of dependent on hardware you have. As long as you are seeing CPU's in use (and the output file is increasing in size) hang in there :-)

ADD REPLYlink written 7 weeks ago by genomax69k

that is the point the output is always zero byte even after 12 hours .. that is why i posted my question here actually

ADD REPLYlink written 7 weeks ago by ta_awwad220

nor output sam file

My apologies. We missed this important bit in your original question. In that case you should probably kill the job since this is not going anywhere. The output file should have been instantly made and will keep growing over time.

Have you used this program successfully before on this computer? Is it known to work properly? Has the index been successfully used before?

ADD REPLYlink modified 7 weeks ago • written 7 weeks ago by genomax69k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1652 users visited in the last hour