Entering edit mode
6.1 years ago
Kash
▴
110
Hi everyone,
I am looking at a VCF file and at one position, under ALT I saw the following nucleotides
T,GATCACGTGCCTGATCATGCACTT
- Can someone please tell what the second ALT allele (GATCACGTGCCTGATCATGCACTT) is?
In another position I see REF and ALT as following
GTGATCACGTGACTGATCATGCAC CTGATCACGTGACTGATCATGCAC,G
- Please tell me how to explain this as well
I think OP asks about the comma, which indicates that at this position there are two alternative alleles. The samples with e.g. 0/1 genotype are heterozygous for the first alternative allele, and 2/2 would mean homozygous for the second alternative allele.
Yes ATpoint that is what I wanted to know. Thank you. In the second position one of the ALT alleles is just G. Does this indicate a deletion at this position in some of the samples?
Yes, the first case is an insertion, one allele is "T", the other is "GATCACGTGCCTGATCATGCACTT"
The second case is a deletion, your reference is "GTGATCACGTGACTGATCATGCAC", then you have one allele "CTGATCACGTGACTGATCATGCAC" (note the single substitution in the first base G->C) and a second allele as "G------------" as a deletion
Now I understand it. Thank you everyone.