Question: How to get sample names and genotype for SNP in multi-sample VCF file
3
gravatar for hellbio
13 months ago by
hellbio360
hellbio360 wrote:

Dear all,

I have a multi-sample (>100) VCF file and a list of SNPs with CHR and POS for which the sample names and their genotypes need to be extracted.

For example, i have a SNP chr1:23455. I would like to know how many and which samples have homozygous alternate allele, heterozygous allele and homozygous reference allele.

Is there any existing tool that provides the above summary?

Many thanks!!!

snp genotype gatk • 1.4k views
ADD COMMENTlink modified 8 months ago by Pierre Lindenbaum117k • written 13 months ago by hellbio360
12
gravatar for Kevin Blighe
13 months ago by
Kevin Blighe39k
Republic of Ireland
Kevin Blighe39k wrote:

Hope that you're ready for this...

As Ram mentioned, you must normalise your VCF / BCF first; otherwise, this script will not work as expected. You can do this with:

bcftools norm -m-any MyVariants.vcf -Ov > MyVariants.Norm.vcf

I probably should explain what's going on here, too: It is divided into 4 parts (each part indicated by the starting <(bcftools on each line):

  1. tabulates the number of samples having each variant type (as you requested). This will work for phased and/or unphased variants. The output is the 3 columns named nHet, nHomAlt, nHomRef

  2. Looks through the file a second time, saves the sample names into an array called 'header', and then prints the indices of the array where a particular field (i.e. sample) has a particular type of variant. This is repeated for: a, heterozygous (HetSamples), b, homozygous (alt) (HomSamplesAlt), and c, homozygouse (ref) (HomSamplesRef).

  3. (see 2)

  4. (see 2)

I've tested it and verified results on a handful of 1000 Genome variants. I strongly encourage you to do some rigorous testing.

paste <(bcftools view MyVariants.Norm.vcf | awk -F"\t" 'BEGIN {print "CHR\tPOS\tID\tREF\tALT\tnHet\tnHomAlt\tnHomRef"} \
    !/^#/ {hetCount=gsub(/0\|1|1\|0|0\/1|1\/0/,""); \
    homCountAlt=gsub(/1\|1|1\/1/,""); \
    homCountRef=gsub(/0\|0|0\/0/,""); \
    print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t"hetCount"\t"homCountAlt"\t"homCountRef}') \
    \
<(bcftools view MyVariants.Norm.vcf | awk -F"\t" '/^#CHROM/ {split($0, header, "\t"); print "HetSamples"} \
    !/^#CHROM/ {for (i=10; i<=NF; i++) {if (gsub(/0\|1|1\|0|0\/1|1\/0/, "", $(i))==1) {printf header[i]","}; if (i==NF) {printf "\n"}}}') \
    \
<(bcftools view MyVariants.Norm.vcf | awk -F"\t" '/^#CHROM/ {split($0, header, "\t"); print "HomSamplesAlt"} \
    !/^#CHROM/ {for (i=10; i<=NF; i++) {if (gsub(/1\|1|1\/1/, "", $(i))==1) {printf header[i]","}; if (i==NF) {printf "\n"}}}') \
    \
<(bcftools view MyVariants.Norm.vcf | awk -F"\t" '/^#CHROM/ {split($0, header, "\t"); print "HomSamplesRef"} \
    !/^#CHROM/ {for (i=10; i<=NF; i++) {if (gsub(/0\|0|0\/0/,"", $(i))==1) {printf header[i]","}; if (i==NF) {printf "\n"}}}') \
    \
| sed 's/,\t/\t/g' | sed 's/,$//g'

CHR POS     ID                  REF ALT nHet nHomAlt nHomRef    HetSamples  HomSamplesAlt   HomSamplesRef
1   10177   1:10177:10177:A:AC  A   AC  4   0   1   HG00096,HG00097,HG00099,HG00100     HG00101
1   10235   1:10235:10235:T:TA  T   TA  0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   10352   1:10352:10352:T:TA  T   TA  5   0   0   HG00096,HG00097,HG00099,HG00100,HG00101     
1   10616   1:10616:10616:CCGCCGTTGCAAAGGCGCGCCG:C  CCGCCGTTGCAAAGGCGCGCCG  C   0   5   0       HG00096,HG00097,HG00099,HG00100,HG00101 
1   10642   1:10642:10642:G:A   G   A   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   11008   1:11008:11008:C:G   C   G   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   11012   1:11012:11012:C:G   C   G   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   11063   1:11063:11063:T:G   T   G   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   13110   1:13110:13110:G:A   G   A   1   0   4   HG00097     HG00096,HG00099,HG00100,HG00101
1   13116   1:13116:13116:T:G   T   G   2   0   3   HG00097,HG00101     HG00096,HG00099,HG00100
1   13118   1:13118:13118:A:G   A   G   2   0   3   HG00097,HG00101     HG00096,HG00099,HG00100
1   13273   1:13273:13273:G:C   G   C   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   13284   1:13284:13284:G:A   G   A   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   13380   1:13380:13380:C:G   C   G   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   13483   1:13483:13483:G:C   G   C   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   13494   1:13494:13494:A:G   A   G   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   13550   1:13550:13550:G:A   G   A   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   14464   1:14464:14464:A:T   A   T   1   1   3   HG00099 HG00096 HG00097,HG00100,HG00101
1   14599   1:14599:14599:T:A   T   A   2   0   3   HG00097,HG00099     HG00096,HG00100,HG00101
1   14604   1:14604:14604:A:G   A   G   2   0   3   HG00097,HG00099     HG00096,HG00100,HG00101
1   14930   1:14930:14930:A:G   A   G   5   0   0   HG00096,HG00097,HG00099,HG00100,HG00101     
1   14933   1:14933:14933:G:A   G   A   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   15211   1:15211:15211:T:G   T   G   5   0   0   HG00096,HG00097,HG00099,HG00100,HG00101     
1   15245   1:15245:15245:C:T   C   T   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   15274   1:15274:15274:A:G   A   G   3   0   2   HG00096,HG00100,HG00101     HG00097,HG00099
1   15274   1:15274:15274:A:T   A   T   3   2   0   HG00096,HG00100,HG00101 HG00097,HG00099 
1   15585   1:15585:15585:G:A   G   A   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   15644   1:15644:15644:G:A   G   A   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   15774   1:15774:15774:G:A   G   A   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
1   15777   1:15777:15777:A:G   A   G   0   0   5           HG00096,HG00097,HG00099,HG00100,HG00101
ADD COMMENTlink modified 4 months ago • written 13 months ago by Kevin Blighe39k

Dear Kevin/Sam, these are exactly what I need. However, I am wondering how to output the results into a file (e.g. a text file) instead of printing all of them in the screen. I am sorry that I am a true beginner of this field.

ADD REPLYlink written 6 weeks ago by wyang310

Hey, you just need to use the '>' character, which instructs the shell to re-direct the output of the command. The default is to send the command output to STDOUT, i.e., the screen.

For example, look at these examples:

echo "test"
echo "test" > out.out

What is contained in out.out? Now do the same to the other commands that you are using.

ADD REPLYlink written 6 weeks ago by Kevin Blighe39k
1

Wonderful! This works out perfectly! I am able to save it into a text file by adding '>' at the end of the code. Thanks a million for your help! I have been bothered by the this task (get variant counts (0/1 or 1/1) per SNP and print the sample ID out) for the whole weekend. Finally I found this poster which saved my life!

ADD REPLYlink written 6 weeks ago by wyang310

Okay - great. If you have multi-allelic records in your VCF/BCF, though, then you should split these before running the above script. Multi-allelic records may look like this:

5  166777  rs3811360  C  A,T  .  PASS  .  GT  1/2

These should be split with bcftools norm -m-any and would then become:

5  166777  rs3811360  C  A  .  PASS  .  GT  0/1
5  166777  rs3811360  C  T  .  PASS  .  GT  0/1

Also, please note that the script works for both phased and / or un-phased genotypes. Please check some of your output to ensure that it does exactly what you need.

ADD REPLYlink modified 6 weeks ago • written 6 weeks ago by Kevin Blighe39k
4
gravatar for RamRS
13 months ago by
RamRS20k
Houston, TX
RamRS20k wrote:

I'd use bcftools query to output a file containing %GT, and then process that file using R or python or even awk

ADD COMMENTlink modified 13 months ago • written 13 months ago by RamRS20k

Yes, take a look at my previous answer here: A: calculate Per variant Heterozygosity from VCF file

ADD REPLYlink modified 6 weeks ago • written 13 months ago by Kevin Blighe39k

So,bcftools norm -m - -Ou $VCF | your_one_liner?

ADD REPLYlink modified 13 months ago • written 13 months ago by RamRS20k

Something along those lines - yes. It is critical to normalise the VCF first.

Also, this does not output sample names that have each genotype. That would require extra coding

ADD REPLYlink modified 6 weeks ago • written 13 months ago by Kevin Blighe39k
1

Sample names with each GT would be bcftools query -f "... %GT"

ADD REPLYlink written 13 months ago by RamRS20k

do you mean that it should be done in steps? to get counts and sample names?

ADD REPLYlink written 13 months ago by hellbio360

From what i can see, it would be better to break it up into different steps and then merge the output. I know how to do it but don't have time right now. I may try later today. Of course, somebody else may have a solution by then.

ADD REPLYlink written 13 months ago by Kevin Blighe39k

Yep, you'll need at least 2 - a "map" step to get genotypes for each individual at each site and a "reduce" step, to get counts or a CSV-list of per-genotype individuals.

ADD REPLYlink written 13 months ago by RamRS20k

I've posted an answer below, in part because you'll appreciate the greater room in viewing the code. Thanks to Ram for input (upvote)

ADD REPLYlink written 13 months ago by Kevin Blighe39k
1
gravatar for Pierre Lindenbaum
8 months ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum117k wrote:

use bioalcidaejdk http://lindenb.github.io/jvarkit/BioAlcidaeJdk.html and the following script:


// all the types of Genotypes see https://samtools.github.io/htsjdk/javadoc/htsjdk/htsjdk/variant/variantcontext/GenotypeType.html
final List<GenotypeType> all_types = Arrays.asList(GenotypeType.values());
//print the header
println("CHROM\tPOS\tREF\tALT\t"+all_types.stream().map(T->"count."+T.name()+"\tsample."+T.name()).collect(Collectors.joining("\t")));
//for each variant
stream().forEach(V->println(
    //print the contig
    V.getContig()+"\t"+
    // print the position
    V.getStart()+"\t"+
    // print the REF alleles
    V.getReference().getDisplayString()+"\t"+
    // print the ALT alleles
    V.getAlternateAlleles().stream().map(A->A.getDisplayString()).collect(Collectors.joining(","))+"\t"+
    // loop over each type
    all_types.stream().map(T->

        String.valueOf(
            // collect all genotypes
            V.getGenotypes().stream().
            //genotype must have type T
            filter(G->G.getType().equals(T)).
            count()) +
        "\t"+
        // collect all genotypes
        V.getGenotypes().stream().
            //genotype must have type T
            filter(G->G.getType().equals(T)).
            //convert to sample name
            map(G->G.getSampleName()).
            // join string
            collect(Collectors.joining(","))
        ).
        collect(Collectors.joining("\t")))
    );

a one-liner:

$ java -jar dist/bioalcidaejdk.jar -e 'final List<GenotypeType> all_types = Arrays.asList(GenotypeType.values());println("CHROM\tPOS\tREF\tALT\t"+all_types.stream().map(T->"count."+T.name()+"\tsample."+T.name()).collect(Collectors.joining("\t")));stream().forEach(V->println( V.getContig()+"\t"+ V.getStart()+"\t"+ V.getReference().getDisplayString()+"\t"+ V.getAlternateAlleles().stream().map(A->A.getDisplayString()).collect(Collectors.joining(","))+"\t"+ all_types.stream().map(T-> String.valueOf( V.getGenotypes().stream(). filter(G->G.getType().equals(T)). count()) + "\t"+ V.getGenotypes().stream(). filter(G->G.getType().equals(T)). map(G->G.getSampleName()). collect(Collectors.joining(",")) ). collect(Collectors.joining("\t"))) );'  src/test/resources/rotavirus_rf.vcf.gz 


CHROM   POS REF ALT count.NO_CALL   sample.NO_CALL  count.HOM_REF   sample.HOM_REF  count.HET   sample.HET  count.HOM_VAR   sample.HOM_VAR  count.UNAVAILABLEsample.UNAVAILABLE count.MIXED sample.MIXED
RF01    970 A   C   0       4   S1,S2,S3,S4 0       1   S5  0       0   
RF02    251 A   T   0       3   S1,S4,S5    2   S2,S3   0       0       0   
RF02    578 G   A   0       4   S1,S2,S3,S5 0       1   S4  0       0   
RF02    877 T   A   0       4   S2,S3,S4,S5 1   S1  0       0       0   
RF02    1726    T   G   0       3   S1,S4,S5    2   S2,S3   0       0       0   
RF02    1962    TACA    TA  0       4   S2,S3,S4,S5 1   S1  0       0       0   
RF03    1221    C   G   0       3   S1,S4,S5    0       2   S2,S3   0       0   
RF03    1242    C   A   0       4   S1,S2,S3,S5 0       1   S4  0       0   
RF03    1688    T   G   0       4   S1,S2,S3,S4 0       1   S5  0       0   


ADD COMMENTlink modified 8 months ago • written 8 months ago by Pierre Lindenbaum117k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2491 users visited in the last hour