Combining The Paired Reads From Illumina Run

Question: Combining The Paired Reads From Illumina Run

6.5 years ago by

Surya Saha • 230

Surya Saha • 230 wrote:

Hi,

I have two fastq files with the forward(/1) and reverse(/2) paired reads. The reads are not in same order in either file, some pairs are absent/missing and the files are 8 GB each with abt 30 mill reads each.

I am trying to pull out all the paired reads for which both fwd and rev exist and running out of memory using a Bioperl script. Are there any C or C++ based efficient tools out there for doing this? Any algorithm ideas where I don't need to read in both read files into memory and can just parse through them.

Thanks!

-S.

paired bioperl scripting • 9.6k views

ADD COMMENT • link •

modified 4.3 years ago by Eric Normandeau ♦ 9.5k • written 6.5 years ago by Surya Saha • 230

4.3 years ago by

Eric Normandeau ♦ 9.5k

Quebec, Canada

Eric Normandeau ♦ 9.5k wrote:

(2013-06-09 EDIT: After a comment from a user, I have fixed a bug in the script. The version on GitHub is up-to-date)

This script that I wrote combines two fastq files that have been trimmed and contain orphans. It should be using MUCH less memory than the AWK script for big files:

https://github.com/enormandeau/Scripts/blob/master/fastqCombinePairedEnd.py

It reads one sequence from file1, searches in hash2 is the corresponding sequence has been read yet. If yes, it writes both sequences to files, if not, it adds the sequence to hash1. Then, a sequence is read from file2, with the same pattern until the end of both files.

Here would be an example call to it:

python fastqCombinePairedEnd.py  fastq1  fastq2

NOTE: If it can be assumed that sequences in both files are ordered, the script could be made much more memory efficient at the expense of a bit more computation. For example, if we read sequence X in fastq1 and that it is also in fastq2, it could be assumed that all sequences that have been added to hash1 before can be flushed. This would lead to a very low memory footprint.

ADD COMMENT • link modified 4.3 years ago • written 4.3 years ago by Eric Normandeau ♦ 9.5k

Thanks for great script! Very fast implementation. However, I would like to add that for me it works only in python 2.7.3 environment.

ADD REPLY • link written 4.0 years ago by Biomonika (Noolean) ♦ 3.0k

My pleasure :) Do you mean it does not work with Python 3 (which it is not supposed to) or that it does not work in older environments (like Python 2.6)?

ADD REPLY • link modified 4.0 years ago • written 4.0 years ago by Eric Normandeau ♦ 9.5k

Works a treat,

Thanks Eric!

ADD REPLY • link written 2.5 years ago by Jonathan Crowther • 160

My pleasure to see that this script is still being used by new people.

ADD REPLY • link modified 2.3 years ago • written 2.3 years ago by Eric Normandeau ♦ 9.5k

Thanks for the script

ADD REPLY • link modified 2.0 years ago • written 2.0 years ago by dmenning • 0

This script is executing fine on my laptop...gives perfect results when I execute it on my laptop. But when I try to execute it on the server, it generates blank files. I don't know why. The operating system of my server is Debian. Do have any Idea like how can I fix this??

ADD REPLY • link modified 11 months ago • written 11 months ago by swadha • 10

The script was written for Python 2.7. There is a possibility it will not work if you are using Python 3.x the server. You can test this with which python.

ADD REPLY • link written 11 months ago by Eric Normandeau ♦ 9.5k

It doesn't work for me.

$ python --version

Python 2.7.13

$ which python

/Library/Frameworks/Python.framework/Versions/2.7/bin/python

I run "python fastqCombinePairedEnd.py fastq1 fastq2". My fastq1 is 4.6 MB and fastq2 is 4.5MB. The command run quickly. Two output files (_pairs_R1.fastq and _pairs_R2.fastq) do not have sequences (0 bytes). The xx_singles.fastq is 9.2 MB.

For more information: The header of 1st sequence in fastq1:

@M03670:6:000000000-BCN4V:1:1101:16480:1645_SUB_CMP reverse_score=80.0; status=partial; direction=reverse; tail_quality=39.0; reverse_match=ccacctatcacataatcatg; seq_length_ori=151; seq_length=121; sample=BI_0_1_1; experiment=eDNA; location=BI_0; mid_quality=38.5267175573; head_quality=33.3; avg_quality=38.2119205298; grab=BI_0_1; reverse_primer=ccacctatcacayaatcatg; 1:N:0:1

The header of 1st sequence in fastq2:

@M03670:6:000000000-BCN4V:1:1101:16480:1645_SUB_CMP reverse_score=76.0; status=partial; direction=reverse; tail_quality=38.5; reverse_match=aagggcaccacaagaacgc; seq_length_ori=151; seq_length=122; sample=BI_0_1_1; experiment=eDNA; location=BI_0; mid_quality=38.3893129771; head_quality=34.6; avg_quality=38.1456953642; grab=BI_0_1; reverse_primer=aagggcaccacaagaacgc; 2:N:0:1

ADD REPLY • link modified 7 days ago • written 7 days ago by hexphe • 10

As I replied to you on GitHub: If you launch the command with " " at the end, it will tell the script to use a space as a separator. Your name format is a bit strange so possibly you'll need to test some other options. Please report if this solves your problem. If not, please contact me by email with sample files (~100 sequences per file) so we can find a solution.

ADD REPLY • link written 7 days ago by Eric Normandeau ♦ 9.5k

The new script you sent to me by email works when I use " " as a separator. Thank you very much for your help!

ADD REPLY • link modified 6 days ago • written 6 days ago by hexphe • 10

awk '{printf substr($0,1,length-2);getline;printf "\t"$0;getline;getline;print "\t"$0}' read1.fq | sort -S 8G -T. > read1.txt awk '{printf substr($0,1,length-2);getline;printf "\t"$0;getline;getline;print "\t"$0}' read2.fq | sort -S 8G -T. > read2.txt join read1.txt read2.txt | awk '{print $1"\n"$2"\n+\n"$3 > "r1.fq";print $1"\n"$4"\n+\n"$5 > "r2.fq"}'

Similar posts • Search »