Convert sequence file to fasta format using python

Question: Convert sequence file to fasta format using python

3.5 years ago by

MAPK • 1.7k

MAPK • 1.7k wrote:

Hi I am new in python and want to see how this can be done in python (I can do this in R). I have a text file myfile.txt with one column and thousands of rows as shown below. I want to convert this to fasta result.fasta format as shown below. How can I do this in python?

myfile.txt

ATGTGTGGTTTTCCCCC
ATTGGCGGGGTTTTTCAGGGG
ATGGGGGGGCCCCCCCCAAAAAA
TTGGTGGGGGGGGGGGGAA

result.fasta

>1
ATGTGTGGTTTTCCCCC
>2
ATTGGCGGGGTTTTTCAGGGG
>3
ATGGGGGGGCCCCCCCCAAAAAA
>4
TTGGTGGGGGGGGGGGGAA

python • 9.2k views

ADD COMMENT • link •

modified 3.5 years ago by Matt Shirley ♦ 9.5k • written 3.5 years ago by MAPK • 1.7k

3.5 years ago by

Kevin Blighe ♦ 70k

Republic of Ireland

Kevin Blighe ♦ 70k wrote:

Create a new script called ConvertFASTA.py:

import sys

#File input
fileInput = open(sys.argv[1], "r")

#File output
fileOutput = open(sys.argv[2], "w")

#Seq count
count = 1 ;

#Loop through each line in the input file
print "Converting to FASTA..."
for strLine in fileInput:

    #Strip the endline character from each input line
    strLine = strLine.rstrip("\n")

    #Output the header
    fileOutput.write(">" + str(count) + "\n")
    fileOutput.write(strLine + "\n")

    count = count + 1
print ("Done.")

#Close the input and output file
fileInput.close()
fileOutput.close()

Then, run it with:

python ConvertFASTA.py myfile.txt result.fasta

ADD COMMENT • link modified 3.5 years ago • written 3.5 years ago by Kevin Blighe ♦ 70k

For the OP, Kevin did a good job showing the pseudocode, and each step.This will run in the same fashion.

#!/usr/bin/env python
import sys
n = 0
with open(sys.argv[1], 'r') as f:
    with open(sys.argv[2], 'w') as out:
        for line in f:
            n += 1
            out.write('>' + str(n) + '\n' + line.strip())

ADD REPLY • link written 3.5 years ago by st.ph.n • 2.6k

I also have the similar query but I want to use the names of sequences to be used after the '>' symbol. for example:

Zebrafish ESLLRFGLRSDLDFR
Fugu ETVLSVGLSAETEIS
Chicken RALLAWGYSSDT

and I want:

result.fasta

>Zebrafish
ESLLRFGLRSDLDFR
 >Fugu
ETVLSVGLSAETEIS
>Chicken
RALLAWGYSSDT

Can I get some guidelines?

ADD REPLY • link written 2.6 years ago by mdsiddra • 30

Sometimes if you try and search for this type of information you would not need to wait to get an answer. Here is one solution.

ADD REPLY • link written 2.6 years ago by GenoMax ♦ 96k

I am really thankful for your support. I would want to discuss that I receive an error,

    fileInput = open(sys.argv[1], "r")
IndexError: list index out of range

when I try using this solution (code) on windows OS and I do not use linux. Since according to my knowledge, argv is the built-in array of linux and so I guess it does not work when I run the script in python IDLE (3.6.4).

ADD REPLY • link modified 2.6 years ago • written 2.6 years ago by mdsiddra • 30

3.5 years ago by

Alex Reynolds ♦ 31k

Seattle, WA USA

Alex Reynolds ♦ 31k wrote:

Something a bit simpler and should work in Python 2 and 3:

#!/usr/bin/env python

import sys

c = 1
for l in sys.stdin:
    sys.stdout.write(">%d\n%s\n" % (c, l))
    c += 1

Usage:

$ convert.py < in.txt > out.fa

ADD COMMENT • link modified 2.6 years ago • written 3.5 years ago by Alex Reynolds ♦ 31k

I think you want sys.stdout.write

ADD REPLY • link written 3.5 years ago by Matt Shirley ♦ 9.5k

You're write, thanks. Fixed!

ADD REPLY • link written 3.5 years ago by Alex Reynolds ♦ 31k

Or even simpler:

import sys

for c, l in enumerate(sys.stdin, start=1):
    sys.stdout.write(">%d\n%s\n" % (c, l))

ADD REPLY • link modified 3.5 years ago • written 3.5 years ago by a.zielezinski ♦ 9.6k

3.5 years ago by

st.ph.n • 2.6k

Philadelphia, PA

st.ph.n • 2.6k wrote:

#!/usr/bin/env python

n = 0
with open('myfile.txt', 'r') as f:
    for line in f:
        n += 1
        print('>' + str(n) + '\n' + line.strip())

ADD COMMENT • link modified 3.5 years ago • written 3.5 years ago by st.ph.n • 2.6k

Thanks, but it does not increase the fasta identifier as >1, >2, >3.... All sequences are named >1.

ADD REPLY • link modified 3.5 years ago • written 3.5 years ago by MAPK • 1.7k

See edit, wrote it too quickly :)

ADD REPLY • link written 3.5 years ago by st.ph.n • 2.6k

To be fair to all posters you should accept all answers that work.

ADD REPLY • link written 3.5 years ago by GenoMax ♦ 96k

I agree, is that feature not available? It would help users to see various ways of doing it. Apologies, I was composing my solution whilst the other guy had posted!

ADD REPLY • link modified 3.5 years ago • written 3.5 years ago by Kevin Blighe ♦ 70k

Thanks to everyone, all answers accepted! Wasn't aware of this feature. I was thinking it was similar to stackoverflow where you have option to accept only one answer.

ADD REPLY • link modified 3.5 years ago • written 3.5 years ago by MAPK • 1.7k

One of the friendly features of Biostars. More than one ways of doing things and all instructive for those new to python.

ADD REPLY • link modified 3.5 years ago • written 3.5 years ago by GenoMax ♦ 96k

3.5 years ago by

Matt Shirley ♦ 9.5k

Cambridge, MA

Matt Shirley ♦ 9.5k wrote:

FOUR! 🏌⛳️

$ python -c "import sys; [sys.stdout.write('>'+str(i)+'\n'+seq) for i, seq in enumerate(sys.stdin)]"

ADD COMMENT • link written 3.5 years ago by Matt Shirley ♦ 9.5k

Please log in to add an answer.

Similar posts • Search »