Biostar

798 results • Page 1 of 16

is more lethal than basic to basic changes ) it makes ? This is on a genome scale and truly based on codon rather than the genomic location. Eg: A to G change (Transition) will affect all codons containing A, but degeneracy of the...codon will maintain same amino acids (eg: UUA and UUG produces Leucine). So considering all the changes one mutation could make

codon mutation

updated 11.3 years ago • Gvj

I'm trying to get a sub-sequence with only 4 fold, 3 fold ,etc degenerate codons. I found this part of the biopython cookbook that has some functions that could do this [link]. However the code keeps...I'm trying to get a sub-sequence with only 4 fold, 3 fold ,etc degenerate codons. I found this part of the biopython cookbook that has some functions that could do this [link]. However the code kee…

biopython

updated 7.1 years ago • ckan91

how can i find frequent to rare codon from a nucleotide sequence? The frequent codons are those which are having the highest value for a particular amino...acid in the codon table and the rare codons are those which are having the lowest value for the same amino acid. For eg: In Codon usage table...of human: for the amino acid F, TTC -> TTT is the change from frequent to rare codon in …

codon perl snp

updated 13.3 years ago • Elena

Hi there! I am trying to pull out a particular codon out of my DNA sequence and run it through a codon table/dictionary to get it to replace with another degenerate codon...I have managed to slice the particular codon out but I am not sure how to run it through the codon table and make it replace accordingly so that the amino acid is still...the same. Eg. I do not want UCA as my codon, hence I …

DNA Python

updated 3.6 years ago • kilo

Hi all, how can I use CodonW to do codon usage analysis using relative synonymous codon usage (RSCU), codon adaptation index (CAI) and effective number of codons

codon

updated 10 weeks ago • jl056933

from UCSC Genome Browser. In order to enter my sequences into HyPhy, I need to remove all stop codons (or at least those that HyPhy recognizes as stop codons). Is there a way to remove the stop codons from the sequences to

sequence conversion codon

updated 7.7 years ago • Eric

how can I find the list of each codon position on mRNA transcriptome and each position of anti codons on tRNA transcriptome. for example for AAA codon there

genome

updated 6.9 years ago • Sara

Hello smart people! What is the point of `DNA Codons` (`DNA Codon Table`) ? ![enter image description here][1] Don't we do `DNA` --> `RNA` `Transcription` to generate `mRNA` and use `RNA Codon...a sequence of `Amino acids`? ![enter image description here][2] Of Yes, what is the point of DNA Codons? Thanks! [1]: https://i.imgur.com/oKoNYim.png [2]: https://i.imgur.com/S905mpn.png

gene

updated 4.3 years ago • rebelCoder

Hi, I'm looking to download all of the entries in the (http://www.kazusa.or.jp/codon/). Is it possible to do this? To add context, it will be used in a codon optimization software. We are looking in to an HTML parser

codon

updated 9.3 years ago • graphNode

A colleague has just found a Human mutated sequence having a Valine (GTG ) as the initiation codon, instead of the very classical Methionine (ATG). She wonders if this protein could be normally expressed. I found that...A colleague has just found a Human mutated sequence having a Valine (GTG ) as the initiation codon, instead of the very classical Methionine (ATG). She wonders if this protei…

translation mutation codon

updated 10.3 years ago • Pierre Lindenbaum

Hello, I have a multiple sequence alignment (nucleotide) that I'd like to convert to codons, in order to use the REL package in HyPhy. Any advice on how I can make this conversion? Thanks

sequence codon

updated 11.9 years ago • Eric

After annotating with VEP a VCF file, we obtain different fields. One of them is called Codons which represents the affected codon in the transcript of the gene. Below is a screenshot of Insertions from a sample...HGVSp_Short RefSeq Codons 11 p.A843Gfs*12 NM_001110556.2 gct/gGct 158 p.Q694Pfs*23 NM_052897.4 -/C Variants and INDELs affect genes differently...we interpret these…

ensembl codon vep protein

updated 6 months ago • atefe

Hi,I introduced a mitochondrial gene into IGV. The codons of eukaryotes and prokaryotes are not identical. Where can I choose to translate codons in IGV? Thanks

IGV Mitochondria Codon

updated 18 months ago • 3210309939

hello, i am working on genomics area... i am facing a problem on the identification of stop codons. how can i find in silico stop codons from a cds sequences

cds

updated 8.5 years ago • harpreetmanku04

Hi all, I am trying to plot the position of SNP with respect to the codon position, to see, if there is an enrichment in 3rd position of the codon or 1st position. It is easy to do, but I did not find...the genomic coordinates of codon (in 3 nt intervals). I only find the CDS coordinates from UCSC. Is there available information of codon coordinates that

Codon SNP tRNA

updated 21 months ago • Chirag Nepal

I want to know that is there is any suitable tool for extracting start codon and stop codon from the fasta file of multiple protein-coding genes (PCGs). I have downloaded multifasta PCGs (nucleotides...from NCBI; now I want to get the start codon and stop codons of all fasta sequence at a go. Thanks in advance

start codon stop codon

updated 7.1 years ago • kabir.deb0353

Is the stop codon usage of an organism the same as its stop codon count? Also which method is the best in performing the analysis using Python

R codon Stop Python

updated 16 months ago • godwin

this little problem? I am trying to look for the position of the first nucleotide of a metionine codon (or a start codon, whatever you like). For that reason, I am using for and if in this way (here is my code): ```py s_otro_dna = str(otro_dna...donde_M = [] for i in range(0,len(s_otro_dna),3): codon = s_otro_dna[i:i+3] if (codon==['ATG']): donde_M.append(i) ``` *Note*: The typ…

python

updated 10 months ago • andreammo97

Hello, I would like to know the position of a codon stop in a coding transcript. For example if the coding transcript have a length of 1000, the stop codon is at position 1000

Transcript stop codon

updated 3.2 years ago • heureuse

I detected some CDS regions in bacterial genomes which lack stop codon, and the length of CDS is not a multiple of 3: http://www.ebi.ac.uk/ena/data/view/CCD00702 http://www.ebi.ac.uk/ena/data/view

codon

updated 10.3 years ago • Pappu

train a model later. I have this script so far. Basically here I am getting the position of every codon corresponding to the sequence previously split into codons (`codon_list`). This is the script. ```py from pathlib import Path...x=3 spl=[nuc_seq[y-x:y] for y in range(x, len(nuc_seq)+x,x)] # split the nn sequences in codons #print(spl) codon_list.append(spl[30:31]) …

dna codon python pandas

updated 17 months ago • dbykov

variants and then annotated the variants against Ensembl gene models. Now, I have the list of Stop codon lost and Stop codon gained genes. As we always compare the donor genome to reference genome, a stop codon gained in donor...gene is same as stop codon lost in reference gene. How we can know which genome has the functional gene ? It may happen that the stop codon for the translation

codon

updated 11.5 years ago • Ashutosh Pandey

SnpEff changed the original EFF annotation standard to ANN. The EFF field in the VCF contained the codon change which occured in the cancer sample. The new ANN filed just contains the HGVS.c variant notation. The new version...of SnpEff statistic HTML file has a codon change table, so I guess it's not so complicated to convert the HGVS.c notation to codon change, but I just found the ensembl

snp codon sequencing

updated 7.2 years ago • asd

being one if a gene always uses, for each encoded amino acid, the most frequently used synonymous codon in the reference set. The significance cutoff value obtained from a reference set, that is Arabidopsis is 0.836. If per...codon I am getting values higher than the cutoff what does that tell me about the specific codons coding my sequence

codon

updated 4.0 years ago • Eminencegrise

sorry if my knowledge on basic gene sequencing is weak. My problem is - Can I find the number of codons in a peptide using it pdb file and look for the particular codon (717 precise for my peptide) using programs like VMD or

sequence

updated 8.0 years ago • roshanpra

papers on the issue, but I got a doubt about the frequency calculation due a difference in using 64 codons and 61 (excluding the 3 stops)? codon[aac] = num codons aac / num codons in the table codon Do you have a suggestion to use? 64 or

sequence gene

updated 4.3 years ago • schlogl

PCR for two genes ( expression of two gene: B.subtilis ----to--->E.coli) then I need to use codon usage analysis for expression.can yo help me to explain how can I use codon usage analyser? as you know I have two nucleic

codon

updated 9.8 years ago • Samane

I have pairs of coding DNA sequences which I wish to perform pairwise codon alignments via Python, I have "half completed" the process. So far.. I retrive pairs of orthologous DNA sequences from genbank...programs/code (called from Python) that can transfer gaps from aligned peptide sequence pairs onto codons of the corresponding nucleotide sequence pairs. Or programs/code that can carry out t…

biopython python alignment codon

updated 10.4 years ago • a1ultima

this : DNA <- DNAString(dna_temp) protein <- translate(DNA) but in this code start codon is not defined, so it will start from the first letter and doesn't check if it is start codon or not. what should I do for checking

R gene

updated 5.0 years ago • khatami.mahshid

I am looking for a way to extract coding sequences, including their stop codons where available, using a genome and GTF annotations. None of the tools I've come across, including tophat's gtf_to_fasta...and gffread, actually parse out the full sequence with the stop codon. Gffread has a flag -J, "discard any mRNAs that either lack initial START codon or the terminal STOP codon, or have an in-fram…

gtf fasta tophat gffread

updated 7.3 years ago • athey.johnc

TTCGCCGAAGTGCGCCTGCGCCATGACTACGT In this bacterial organism, GTG is an alternative start codon. It means that it can initiate translation via an initiator-tRNA that puts in the amino acid Methionine (M) into the protein...the above sequence will be translated to an amino acid sequence that begins with V regardless if the codon table is standard code or bacterial. In fact, even using command-line…

bacterial codon bacterial code GTG Valine

updated 4.7 years ago • bioinfo2345

errors like Warning: Sequence 280 "DNEG10010009 " does not begin with a recognised start codon. Warning: Sequence 280 "DNEG10010009 " has 16 internal stop codon(s) The input I have provided is a sequence of Nucleotide...is how do I solve this error? Actually all I really want to do is to calculate various values like codon adaptation index,codon bias index,number of optimal codons…

gene sequence codon codonw codon adaptation index

updated 6.9 years ago • somitmittal

Hello, The relative synonymous codon usage(RSCU) was calculated as RSCU = S × Nc/Na, where S represents the number of synonymous codons encoding the same amino...acid, Nc is the frequency of the codon in the genome, and Na is the relative frequency of the codon for that amino acid. I have access to the codon usage database...and I obtained the codon frequencies for the human genome. Amino a…

SNP snp

updated 4.0 years ago • nadiabenjemii

I have this question where we need to write a code that takes a protein fasta file and the protein sequence identifier, and counts all the possible RNA combinations for the sequence in the fasta file, with a condition that the total of combinations should be less than 5000. I started with making an RNA codons dictionary, then I made a function that puts the elements of the fasta file (amino acid…

RNA-Seq sequence

updated 3.4 years ago • shiningsky000

Now they want me to create a list with what it is sequenced, with the gene name, the exon and the codon number. I have reached the point to know which are the exonic parts of the bed file, but I am having struggle to associate...this data to the main isoform of the gene and the exon and codon number. I am using UCSC Browser, but maybe other software works better. Can you please help me

browser codon list ucsc genome

updated 3.1 years ago • ines

with species pretty distant with a poor alignment around 50-60% (This is expected considering the codon degeneracy of the genetic code). When using blastp the major hits are with the species of interest, or within the same family

gene ontology protein blast alignment

updated 5.2 years ago • l.souza

Are there any online services or biopython scripts that will calculate the codon usage average for all sequences in a file not individually for each sequence. I only know python, unix and a little bit

codon

updated 5.5 years ago • Arvalon

Hello! If we apply a basic algorithm to a reading frame to scan it and look for START and STOP codons (to assemble a possible protein), we get cases, when we have multiple START codons and one STOP codon: Example: Reading Frame...M', 'A', 'P', 'M', 'Q', 'P', 'I', 'T', 'P', 'S', 'A', 'T', '_', 'T']` We see that we have two START codons (**M**) and one STOP (_) codons and if we generate a poss…

Translation RNA DNA Codons

updated 4.0 years ago • rebelCoder

with certain genes. The problem is that I cannot find an appropriate Biomart attribute for the start codon position/offset (e.g. if the exon is 5' ACGTCAT...3', whether the first codon is ACG, CGT, or GTC). The closest attribute that I could...As I understand it, a phase of 0 would mean that nucleotide 1 of the exon is the first in the start codon (ACG) above, a phase of 1 means a sequence start…

ensembl biomart exon

updated 10.8 years ago • Max

How I can find the ORF in a sequence using Python? also I need find all codons. Thanks

orf sequence python codon

updated 12.3 years ago • Wilmer Garzon

Can anyone explain how the codon usage table database for Homo sapiens is composed of 93,487 CDS's (source: http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi...species=9606), yet there are only 32,109 instances of the codon UAG? This would mean that certain CDS's did not contain the UAG codon, which does not make sense. There are other "counterintuitive...codons like this in the database table

Codon-Usage-Database RNA-Seq GenBank

updated 15 months ago • Bohdan Khomtchouk

Hi there, Could anybody suggest a number of indexes for measuring the codon bias of each gene in a genome without the expression data? I know one of the most famous indexes is CAI (Codon adaptation...genes. But what if the genome doesn't have any expression data. In this case, how to measure the codon bias in a more efficient way? I also know ENc is the simplest one. Any other newly-developed …

codon bias

updated 6.2 years ago • wangdp123

I have this RNA-seq `ACAGUCGACUAGCUUGCACGUAC` and I want to split it into codons like this (`ACC` and `AGG`) and count the number of complete codon and incomplete codon by using python

python split

updated 23 months ago • m90

Hello! I have a quick question regarding bacterial start codons. I have downloaded the full plasmid database set of sequences from ncbi here: ftp://ftp.ncbi.nlm.nih.gov/genomes/Plasmids...This works quite well, but in some cases the sequence returned does not have a typical start codon which you would expect. Normally, you'd expect to see either ATG, GTG, or TTG as the start codon. But here I am…

codon sequence blast alignment

updated 21 months ago • Jenez

I am using getorf from EMBOSS. I want to include the STOP codon in my output file in the nucleotide format. But no matter what I try, the output is without STOP codon. Any suggestions? Example...TTTGCTATTCCATTTGTTGCCTGTTATGTTCAATTGAAAAAATCTGGTGCTTTT as you can see, this does not have a stop codon in the end. the command that I used is: `hmmer2go getorf -i input.fa -o longest.fa -t3` I want stop …

emboss getorf orf STOP

updated 5.1 years ago • lokdeep17

Is there an existing dataset with snp (vcf) with possible codons? Thanks, pini

SNP

updated 22 months ago • pinikoma

There could be multiple out-frame/overlapping start codons between each primary start and stop codon shown above, or in UTRs. The position of all instances of overlapping in-/out...frame start codons can be found as follows: startCodons = ['ATG','GTG','CTG','TTG'] # Start positions of start codons startCodons_pos = {} for startCodon_seq...m.start() for m in re.findit…

python

updated 2.9 years ago • nobodyknowsme57

How to choose a reference set of highly expressed genes for calculating Codon Adaptation Index? What if I do not have any experimental evidence related to their expression levels or on the other

codon index genes

updated 4.0 years ago • tigeradab

have been listed. I was wondering if there is any software I can use to: 1) add UTRs, start codon and stop codon to the .gff document, 2) convert .gff to the formal .gtf format? Thanks for any suggestions! Best, Issac

genomics annotation RNA-seq long-read genome

updated 20 months ago • Issac

I have looked at the Kazusa pages for codon frequency tables, but find nothing for human mitochondrial (MT) genes. Thus, does anyone know of a source where I can see...the frequency with which each codon is used in genes encoded by the human mitochondria? Searches of the internet and literature turn up genetic code tables...this codon = this amino acid and so on, but no frequencies. I am trying …

mitochondria codon

updated 5.6 years ago • Larry_Parnell

798 results • Page 1 of 16

Recent Votes

Answer: Would you bother re-mapping RNA-seq data from an old GRCh38 build to a newer ver

A: How to process (seems) Agilent microarrry data?

Comment: DEG analysis with limma and contrast matrix using multiple Parkinson's cohorts i

finding evidence(s) of a peptide translated from an "Upstream Open Reading Frame (uORF)"

A: How To Merge Two Fastq.Gz Files?

Answer: Annotating file using bcftools

Answer: Getting differential ChIP-seq peaks between conditions after calling consensus p

Recent Locations • All